Incidental Mutation 'R2292:Olfr1361'
ID245051
Institutional Source Beutler Lab
Gene Symbol Olfr1361
Ensembl Gene ENSMUSG00000049737
Gene Nameolfactory receptor 1361
SynonymsGA_x6K02T2QHY8-11577590-11578528, MOR256-12
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21656880-21663386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21658831 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 164 (M164T)
Ref Sequence ENSEMBL: ENSMUSP00000150315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055615] [ENSMUST00000214321]
Predicted Effect probably damaging
Transcript: ENSMUST00000055615
AA Change: M164T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062356
Gene: ENSMUSG00000049737
AA Change: M164T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 30 312 4.2e-10 PFAM
Pfam:7tm_4 36 313 7.7e-52 PFAM
Pfam:7tm_1 46 295 1.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214321
AA Change: M164T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Olfr1361
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Olfr1361 APN 13 21658783 missense possibly damaging 0.63
IGL02025:Olfr1361 APN 13 21659263 missense possibly damaging 0.92
IGL02275:Olfr1361 APN 13 21659000 missense probably benign 0.01
IGL02831:Olfr1361 APN 13 21658904 missense probably benign
IGL02932:Olfr1361 APN 13 21658831 missense probably damaging 1.00
R0102:Olfr1361 UTSW 13 21658735 missense probably damaging 1.00
R0597:Olfr1361 UTSW 13 21659146 missense probably damaging 0.96
R1669:Olfr1361 UTSW 13 21659286 missense possibly damaging 0.91
R2006:Olfr1361 UTSW 13 21658472 missense possibly damaging 0.94
R4894:Olfr1361 UTSW 13 21659182 missense probably damaging 1.00
R4919:Olfr1361 UTSW 13 21658624 missense possibly damaging 0.59
R5339:Olfr1361 UTSW 13 21659234 missense probably benign 0.37
R5815:Olfr1361 UTSW 13 21658537 missense probably damaging 1.00
R6248:Olfr1361 UTSW 13 21659074 missense possibly damaging 0.72
R8273:Olfr1361 UTSW 13 21659207 missense probably damaging 1.00
R8323:Olfr1361 UTSW 13 21659132 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GATCCTAAACACTGCTCGGG -3'
(R):5'- GGGTTGTGCTATCCAACTGTAC -3'

Sequencing Primer
(F):5'- TGCTCGGGCAATGTAACCATAG -3'
(R):5'- AACTGTACTTTGTCTTAGCCCTGGG -3'
Posted On2014-10-30