Incidental Mutation 'R2292:Fgd4'
ID245057
Institutional Source Beutler Lab
Gene Symbol Fgd4
Ensembl Gene ENSMUSG00000022788
Gene NameFYVE, RhoGEF and PH domain containing 4
SynonymsFrabin-alpha, 9330209B17Rik, ZFYVE6, Frabin-gamma, Frabin-beta, Frabin
MMRRC Submission 040291-MU
Accession Numbers

Genbank: NM_139232; MGI: 2183747

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16416917-16600549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16436000 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 568 (C568S)
Ref Sequence ENSEMBL: ENSMUSP00000069573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069284] [ENSMUST00000161188] [ENSMUST00000161861] [ENSMUST00000162671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069284
AA Change: C568S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069573
Gene: ENSMUSG00000022788
AA Change: C568S

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161188
AA Change: C568S

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123763
Gene: ENSMUSG00000022788
AA Change: C568S

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 603 1.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161861
AA Change: C568S

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125174
Gene: ENSMUSG00000022788
AA Change: C568S

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162671
AA Change: C568S

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125736
Gene: ENSMUSG00000022788
AA Change: C568S

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172181
SMART Domains Protein: ENSMUSP00000131870
Gene: ENSMUSG00000022788

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 603 1.94e-8 SMART
Meta Mutation Damage Score 0.9621 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene is a member of the FYVE, RhoGEF and PH domain containing (FGD) family. The encoded protein is a Cdc42-specific guanine nucleotide exchange factor (GEF) that plays an essential role in regulating the actin cytoskeleton and cell morphology. Disruption of the gene in mouse causes abnormal nerve development and dysmyelination. Mutations in a similar gene in human can cause Charcot-Marie-Tooth disease type 4H (CMT4H), a disorder of the peripheral nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display dysmyelination in early peripheral nerve development, followed by severe myelin abnormalities, demyelinationn, nervous system electrophysiological deficits, and decreased grip strength at later stages. [provided by MGI curators]
Allele List at MGI

All alleles(60) : Gene trapped(60)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Fgd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Fgd4 APN 16 16484303 missense probably damaging 0.99
IGL01455:Fgd4 APN 16 16490490 missense probably benign 0.22
IGL02035:Fgd4 APN 16 16490416 splice site probably benign
IGL02353:Fgd4 APN 16 16462045 missense probably damaging 0.96
IGL02360:Fgd4 APN 16 16462045 missense probably damaging 0.96
IGL03100:Fgd4 APN 16 16477519 splice site probably benign
11287:Fgd4 UTSW 16 16423923 missense probably damaging 1.00
R0787:Fgd4 UTSW 16 16423901 splice site probably benign
R0853:Fgd4 UTSW 16 16474387 splice site probably benign
R0879:Fgd4 UTSW 16 16477449 missense probably damaging 1.00
R1482:Fgd4 UTSW 16 16484473 missense probably benign 0.39
R1619:Fgd4 UTSW 16 16424056 missense possibly damaging 0.52
R1635:Fgd4 UTSW 16 16475029 nonsense probably null
R2018:Fgd4 UTSW 16 16435960 missense probably benign 0.15
R2120:Fgd4 UTSW 16 16425828 missense probably benign 0.44
R2902:Fgd4 UTSW 16 16425865 missense probably damaging 1.00
R4575:Fgd4 UTSW 16 16437032 missense probably damaging 1.00
R4747:Fgd4 UTSW 16 16423929 missense probably damaging 1.00
R4941:Fgd4 UTSW 16 16484538 missense probably benign
R5196:Fgd4 UTSW 16 16484142 missense probably benign 0.01
R5372:Fgd4 UTSW 16 16484291 missense probably benign 0.03
R5457:Fgd4 UTSW 16 16462009 missense probably benign 0.39
R5486:Fgd4 UTSW 16 16475037 missense probably damaging 1.00
R6709:Fgd4 UTSW 16 16484481 missense probably benign 0.09
R6962:Fgd4 UTSW 16 16484087 splice site probably null
R7207:Fgd4 UTSW 16 16484556 missense probably benign 0.11
R7732:Fgd4 UTSW 16 16484595 missense probably benign
R7749:Fgd4 UTSW 16 16475154 missense probably benign 0.02
R7846:Fgd4 UTSW 16 16422726 missense probably damaging 1.00
R7937:Fgd4 UTSW 16 16469773 missense probably damaging 1.00
Z1088:Fgd4 UTSW 16 16484470 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTAAGCAAATATTACTCTCCTGCAC -3'
(R):5'- GAGATCAGAACATGGTTTGAACAAC -3'

Sequencing Primer
(F):5'- CTTCATGGGGCAGCACAATACTTTG -3'
(R):5'- TGAGTTCCAGTACTGCCAAG -3'
Posted On2014-10-30