Incidental Mutation 'R0278:Hspa9'
ID24506
Institutional Source Beutler Lab
Gene Symbol Hspa9
Ensembl Gene ENSMUSG00000024359
Gene Nameheat shock protein 9
SynonymsC3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin
MMRRC Submission 038500-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R0278 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34937414-34954357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34940910 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 482 (V482A)
Ref Sequence ENSEMBL: ENSMUSP00000025217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025217
AA Change: V482A

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: V482A

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:HSP70 55 653 2.7e-270 PFAM
Pfam:FGGY_C 283 429 3e-8 PFAM
low complexity region 657 679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173701
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in Hspa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Hspa9 APN 18 34938580 splice site probably benign
IGL01939:Hspa9 APN 18 34938708 missense possibly damaging 0.89
IGL02008:Hspa9 APN 18 34947975 nonsense probably null
IGL02604:Hspa9 APN 18 34954213 missense unknown
Chiri-san UTSW 18 34939423 missense probably damaging 1.00
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0613:Hspa9 UTSW 18 34947980 missense probably damaging 1.00
R1414:Hspa9 UTSW 18 34938591 missense probably damaging 1.00
R1454:Hspa9 UTSW 18 34938606 missense probably damaging 1.00
R2013:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2014:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2015:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2936:Hspa9 UTSW 18 34948014 missense probably damaging 1.00
R4261:Hspa9 UTSW 18 34939423 missense probably damaging 1.00
R4622:Hspa9 UTSW 18 34949037 missense possibly damaging 0.48
R4819:Hspa9 UTSW 18 34939388 missense probably damaging 0.98
R5056:Hspa9 UTSW 18 34938681 missense probably damaging 1.00
R5223:Hspa9 UTSW 18 34952671 splice site probably null
R5666:Hspa9 UTSW 18 34954247 missense probably null
R5820:Hspa9 UTSW 18 34943174 missense possibly damaging 0.82
R5944:Hspa9 UTSW 18 34949023 missense possibly damaging 0.94
R6460:Hspa9 UTSW 18 34952712 missense probably benign
R7404:Hspa9 UTSW 18 34943276 missense possibly damaging 0.76
R7412:Hspa9 UTSW 18 34949029 missense probably damaging 1.00
R7637:Hspa9 UTSW 18 34938687 missense not run
R7960:Hspa9 UTSW 18 34942099 splice site probably null
Z1177:Hspa9 UTSW 18 34943145 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTGTAGCAATGCTGACCAGAACC -3'
(R):5'- GCTGAAGCAACAGCTATTGTGTGTC -3'

Sequencing Primer
(F):5'- AGCATTGCTTCTGAGTCTGAAC -3'
(R):5'- CTGTTCCTGTCCTTTGTTCTAAGAG -3'
Posted On2013-04-16