Incidental Mutation 'R2292:Dym'
ID245061
Institutional Source Beutler Lab
Gene Symbol Dym
Ensembl Gene ENSMUSG00000035765
Gene Namedymeclin
SynonymsC030019K18Rik, 4933427L07Rik, 1810041M12Rik
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location75018772-75286966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75199212 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 504 (T504A)
Ref Sequence ENSEMBL: ENSMUSP00000047054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039608]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039608
AA Change: T504A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047054
Gene: ENSMUSG00000035765
AA Change: T504A

DomainStartEndE-ValueType
Pfam:Dymeclin 1 646 3.3e-174 PFAM
Pfam:Hid1 309 584 3e-11 PFAM
Meta Mutation Damage Score 0.1038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is necessary for normal skeletal development and brain function. Mutations in this gene are associated with two types of recessive osteochondrodysplasia, Dyggve-Melchior-Clausen (DMC) dysplasia and Smith-McCort (SMC) dysplasia, which involve both skeletal defects and mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele display decreased body size with short tubular bones, chondrodysplasia, partial penetrance of obstructive hydronephrosis and impaired vesicular transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Dym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Dym APN 18 75119249 missense probably benign 0.43
IGL01593:Dym APN 18 75114781 splice site probably benign
IGL02657:Dym APN 18 75082456 nonsense probably null
IGL02716:Dym APN 18 75286683 missense probably damaging 1.00
IGL02977:Dym APN 18 75063175 critical splice donor site probably null
asesino UTSW 18 75056641 missense probably damaging 1.00
flavor UTSW 18 75056738 nonsense probably null
geschmack UTSW 18 75063174 critical splice donor site probably null
sabor UTSW 18 75125539 critical splice donor site probably null
R0042:Dym UTSW 18 75125539 critical splice donor site probably null
R0058:Dym UTSW 18 75043172 missense possibly damaging 0.94
R0058:Dym UTSW 18 75043172 missense possibly damaging 0.94
R0320:Dym UTSW 18 75199262 missense probably damaging 0.99
R0943:Dym UTSW 18 75286769 makesense probably null
R1677:Dym UTSW 18 75125512 missense probably damaging 1.00
R2022:Dym UTSW 18 75080250 missense probably benign 0.05
R2221:Dym UTSW 18 75230165 missense probably damaging 1.00
R4087:Dym UTSW 18 75230101 missense probably damaging 1.00
R4929:Dym UTSW 18 75243286 missense probably damaging 1.00
R5033:Dym UTSW 18 75119161 missense possibly damaging 0.78
R6489:Dym UTSW 18 75080226 missense probably benign 0.27
R6641:Dym UTSW 18 75056641 missense probably damaging 1.00
R6751:Dym UTSW 18 75286647 missense probably damaging 0.98
R6864:Dym UTSW 18 75056738 nonsense probably null
R7284:Dym UTSW 18 75119171 missense possibly damaging 0.60
R7319:Dym UTSW 18 75063174 critical splice donor site probably null
R8095:Dym UTSW 18 75114801 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGCTTGGTCACTGACTAGCC -3'
(R):5'- CTCCTTCCCTGAAGATGTCTAGG -3'

Sequencing Primer
(F):5'- TCACTGACTAGCCGGTTGC -3'
(R):5'- CTAGGGGTGCTTAGACATGGAC -3'
Posted On2014-10-30