Incidental Mutation 'R2293:Dlx6'
ID245074
Institutional Source Beutler Lab
Gene Symbol Dlx6
Ensembl Gene ENSMUSG00000029754
Gene Namedistal-less homeobox 6
Synonyms
MMRRC Submission 040292-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2293 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location6863334-6868568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6867246 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 283 (Y283C)
Ref Sequence ENSEMBL: ENSMUSP00000128585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031768] [ENSMUST00000160937] [ENSMUST00000171311]
Predicted Effect probably damaging
Transcript: ENSMUST00000031768
AA Change: Y144C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031768
Gene: ENSMUSG00000029754
AA Change: Y144C

DomainStartEndE-ValueType
HOX 32 94 7.65e-23 SMART
low complexity region 102 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159568
Predicted Effect probably damaging
Transcript: ENSMUST00000160937
AA Change: Y283C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124204
Gene: ENSMUSG00000029754
AA Change: Y283C

DomainStartEndE-ValueType
low complexity region 26 59 N/A INTRINSIC
low complexity region 79 102 N/A INTRINSIC
HOX 171 233 7.65e-23 SMART
low complexity region 241 257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171311
AA Change: Y283C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128585
Gene: ENSMUSG00000029754
AA Change: Y283C

DomainStartEndE-ValueType
low complexity region 26 59 N/A INTRINSIC
low complexity region 79 102 N/A INTRINSIC
HOX 171 233 7.65e-23 SMART
low complexity region 241 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184182
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations at both Dlx5 and Dlx6 exhibit bilateral ectrodactyly, homeotic transformation of the lower jaw into an upper jaw, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano9 T C 7: 141,102,515 N640S probably benign Het
Aox4 T A 1: 58,221,937 I143N probably damaging Het
Arhgef11 C T 3: 87,727,990 R869C probably damaging Het
Bcl6 T C 16: 23,977,609 N23D probably damaging Het
Brca2 T A 5: 150,560,534 F2939L possibly damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cyp2j6 T A 4: 96,529,433 T318S possibly damaging Het
Dlg5 A C 14: 24,158,112 S1009A probably benign Het
Dnah10 T C 5: 124,819,221 Y3550H probably damaging Het
Dock7 T C 4: 98,966,369 S1553G probably damaging Het
Ice1 C A 13: 70,614,957 D193Y probably damaging Het
Mdga2 A T 12: 66,568,985 L547* probably null Het
Mgat4a C A 1: 37,452,592 R215L probably damaging Het
Msantd2 A G 9: 37,489,804 T69A probably damaging Het
Muc5ac A G 7: 141,807,199 T1416A probably damaging Het
Nup214 T C 2: 32,026,875 S1181P probably benign Het
Pip5k1c A G 10: 81,314,084 E42G possibly damaging Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Slc16a14 A T 1: 84,912,843 M247K probably benign Het
Slc35b2 T A 17: 45,567,141 V398E probably damaging Het
Slc44a5 C A 3: 154,240,297 L156I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Other mutations in Dlx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Dlx6 APN 6 6865143 missense probably damaging 1.00
IGL01081:Dlx6 APN 6 6867068 missense probably damaging 1.00
IGL03034:Dlx6 APN 6 6863807 missense probably benign 0.45
IGL03309:Dlx6 APN 6 6867289 missense possibly damaging 0.77
R0848:Dlx6 UTSW 6 6863665 nonsense probably null
R1004:Dlx6 UTSW 6 6863665 nonsense probably null
R1694:Dlx6 UTSW 6 6867173 missense probably damaging 1.00
R1753:Dlx6 UTSW 6 6863665 nonsense probably null
R2076:Dlx6 UTSW 6 6867098 missense probably benign 0.00
R4488:Dlx6 UTSW 6 6867207 missense probably damaging 0.99
R4574:Dlx6 UTSW 6 6865305 intron probably benign
R4942:Dlx6 UTSW 6 6863468 missense probably benign 0.28
R5102:Dlx6 UTSW 6 6865180 frame shift probably null
R5103:Dlx6 UTSW 6 6865180 frame shift probably null
R5104:Dlx6 UTSW 6 6865180 frame shift probably null
R5105:Dlx6 UTSW 6 6865180 frame shift probably null
R5736:Dlx6 UTSW 6 6863660 missense probably damaging 0.97
R7577:Dlx6 UTSW 6 6863423 missense probably damaging 1.00
R7995:Dlx6 UTSW 6 6867277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGAAGGCACCAGTATGATGT -3'
(R):5'- GGAAGGGGAAGAAAGCAAGGATG -3'

Sequencing Primer
(F):5'- ACTACATGTCTTGCAGGTGAAG -3'
(R):5'- AGCAAGGATGGAAAGATAGGC -3'
Posted On2014-10-30