Incidental Mutation 'R2293:Ano9'
ID245077
Institutional Source Beutler Lab
Gene Symbol Ano9
Ensembl Gene ENSMUSG00000054662
Gene Nameanoctamin 9
Synonyms5430425C04Rik, Tmem16j, Trp53i5, Tp53i5
MMRRC Submission 040292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2293 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141101212-141117806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141102515 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 640 (N640S)
Ref Sequence ENSEMBL: ENSMUSP00000067689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067836] [ENSMUST00000097958] [ENSMUST00000209294] [ENSMUST00000210167]
Predicted Effect probably benign
Transcript: ENSMUST00000067836
AA Change: N640S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067689
Gene: ENSMUSG00000054662
AA Change: N640S

DomainStartEndE-ValueType
Pfam:Anoctamin 174 730 3.3e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097958
SMART Domains Protein: ENSMUSP00000095571
Gene: ENSMUSG00000025494

DomainStartEndE-ValueType
IG 17 112 5.21e-2 SMART
transmembrane domain 117 139 N/A INTRINSIC
Pfam:TIR 163 327 2.2e-19 PFAM
Pfam:TIR_2 166 308 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157917
Predicted Effect probably benign
Transcript: ENSMUST00000209294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210085
Predicted Effect probably benign
Transcript: ENSMUST00000210167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211515
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TMEM16 (anoctamin) family of proteins, some of which form integral membrane calcium-activated chloride channels. The function of the encoded protein has yet to be elucidated, although it may have channel-forming abilities and also may have phospholipid scramblase activity. This gene has been observed to be upregulated in stage II and III colorectal cancers. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T A 1: 58,221,937 I143N probably damaging Het
Arhgef11 C T 3: 87,727,990 R869C probably damaging Het
Bcl6 T C 16: 23,977,609 N23D probably damaging Het
Brca2 T A 5: 150,560,534 F2939L possibly damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cyp2j6 T A 4: 96,529,433 T318S possibly damaging Het
Dlg5 A C 14: 24,158,112 S1009A probably benign Het
Dlx6 A G 6: 6,867,246 Y283C probably damaging Het
Dnah10 T C 5: 124,819,221 Y3550H probably damaging Het
Dock7 T C 4: 98,966,369 S1553G probably damaging Het
Ice1 C A 13: 70,614,957 D193Y probably damaging Het
Mdga2 A T 12: 66,568,985 L547* probably null Het
Mgat4a C A 1: 37,452,592 R215L probably damaging Het
Msantd2 A G 9: 37,489,804 T69A probably damaging Het
Muc5ac A G 7: 141,807,199 T1416A probably damaging Het
Nup214 T C 2: 32,026,875 S1181P probably benign Het
Pip5k1c A G 10: 81,314,084 E42G possibly damaging Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Slc16a14 A T 1: 84,912,843 M247K probably benign Het
Slc35b2 T A 17: 45,567,141 V398E probably damaging Het
Slc44a5 C A 3: 154,240,297 L156I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Other mutations in Ano9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ano9 APN 7 141102042 nonsense probably null
IGL01620:Ano9 APN 7 141110439 missense probably damaging 1.00
IGL02045:Ano9 APN 7 141102469 missense probably benign 0.00
IGL02506:Ano9 APN 7 141102254 unclassified probably benign
IGL02657:Ano9 APN 7 141107440 missense probably damaging 1.00
IGL02731:Ano9 APN 7 141107204 missense probably damaging 1.00
IGL02863:Ano9 APN 7 141108651 missense probably benign 0.00
R0114:Ano9 UTSW 7 141103239 unclassified probably benign
R0374:Ano9 UTSW 7 141107814 missense probably damaging 0.98
R0487:Ano9 UTSW 7 141107849 missense possibly damaging 0.85
R0600:Ano9 UTSW 7 141104710 missense probably damaging 1.00
R0702:Ano9 UTSW 7 141107282 missense probably damaging 1.00
R0765:Ano9 UTSW 7 141107184 missense probably damaging 1.00
R1679:Ano9 UTSW 7 141108297 missense probably benign 0.03
R1773:Ano9 UTSW 7 141108378 missense possibly damaging 0.95
R1809:Ano9 UTSW 7 141108804 missense possibly damaging 0.93
R1883:Ano9 UTSW 7 141102331 missense probably benign
R2034:Ano9 UTSW 7 141108135 missense probably damaging 0.99
R2159:Ano9 UTSW 7 141108117 missense probably benign 0.01
R2254:Ano9 UTSW 7 141103090 missense probably benign
R3177:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R3277:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R4274:Ano9 UTSW 7 141110695 missense probably benign
R4576:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4577:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4872:Ano9 UTSW 7 141107204 missense probably damaging 1.00
R4879:Ano9 UTSW 7 141110502 missense probably benign 0.23
R5160:Ano9 UTSW 7 141104365 missense probably damaging 1.00
R5560:Ano9 UTSW 7 141110482 missense probably damaging 1.00
R6148:Ano9 UTSW 7 141106785 missense probably damaging 1.00
R6302:Ano9 UTSW 7 141104308 missense probably damaging 1.00
R6821:Ano9 UTSW 7 141107256 missense possibly damaging 0.70
R7253:Ano9 UTSW 7 141107437 missense probably damaging 0.96
R7479:Ano9 UTSW 7 141102435 missense probably damaging 0.99
R7836:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R7919:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R8051:Ano9 UTSW 7 141104532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTCATTTCGGTAGTCCC -3'
(R):5'- AGGGCAGACTGTTGATAGCATC -3'

Sequencing Primer
(F):5'- TAGTCCCGGTACCTGGAGTAG -3'
(R):5'- GACTGTTGATAGCATCCCCAAAAC -3'
Posted On2014-10-30