Mutagenetix > Incidental Mutation

Incidental Mutation 'R2293:Pip5k1c'

245082

Institutional Source

Beutler Lab

Gene Symbol

Pip5k1c

Ensembl Gene

ENSMUSG00000034902

Gene Name

phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma

Synonyms

PIP5KIgamma

MMRRC Submission

040292-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2293 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81292963-81319973 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81314084 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 42 (E42G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000160291] [ENSMUST00000161719] [ENSMUST00000161854] [ENSMUST00000161869] [ENSMUST00000163075]

AlphaFold

O70161

Predicted Effect

probably benign
Transcript: ENSMUST00000045469
AA Change: E590G

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: E590G

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
PIPKc	103	444	2.72e-164	SMART
low complexity region	518	534	N/A	INTRINSIC
low complexity region	575	591	N/A	INTRINSIC
low complexity region	601	628	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105327
AA Change: E590G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902
AA Change: E590G

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
PIPKc	103	444	2.72e-164	SMART
low complexity region	518	534	N/A	INTRINSIC
low complexity region	575	591	N/A	INTRINSIC
low complexity region	601	628	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159636

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159895

Predicted Effect

probably benign
Transcript: ENSMUST00000160291

SMART Domains

Protein: ENSMUSP00000125645
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161586
AA Change: E42G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902
AA Change: E42G

Domain	Start	End	E-Value	Type
low complexity region	28	44	N/A	INTRINSIC
low complexity region	54	81	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161719

SMART Domains

Protein: ENSMUSP00000125461
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
Pfam:PIP5K	1	133	1.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161854

SMART Domains

Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161869

SMART Domains

Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	7	36	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163075
AA Change: E590G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902
AA Change: E590G

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
PIPKc	103	444	2.72e-164	SMART
low complexity region	518	534	N/A	INTRINSIC
low complexity region	575	591	N/A	INTRINSIC
low complexity region	601	628	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano9	T	C	7: 141,102,515	N640S	probably benign	Het
Aox4	T	A	1: 58,221,937	I143N	probably damaging	Het
Arhgef11	C	T	3: 87,727,990	R869C	probably damaging	Het
Bcl6	T	C	16: 23,977,609	N23D	probably damaging	Het
Brca2	T	A	5: 150,560,534	F2939L	possibly damaging	Het
Bsn	C	T	9: 108,113,067	A1829T	possibly damaging	Het
Cyp2j6	T	A	4: 96,529,433	T318S	possibly damaging	Het
Dlg5	A	C	14: 24,158,112	S1009A	probably benign	Het
Dlx6	A	G	6: 6,867,246	Y283C	probably damaging	Het
Dnah10	T	C	5: 124,819,221	Y3550H	probably damaging	Het
Dock7	T	C	4: 98,966,369	S1553G	probably damaging	Het
Ice1	C	A	13: 70,614,957	D193Y	probably damaging	Het
Mdga2	A	T	12: 66,568,985	L547*	probably null	Het
Mgat4a	C	A	1: 37,452,592	R215L	probably damaging	Het
Msantd2	A	G	9: 37,489,804	T69A	probably damaging	Het
Muc5ac	A	G	7: 141,807,199	T1416A	probably damaging	Het
Nup214	T	C	2: 32,026,875	S1181P	probably benign	Het
Slc12a5	A	G	2: 164,992,330	E757G	probably benign	Het
Slc16a14	A	T	1: 84,912,843	M247K	probably benign	Het
Slc35b2	T	A	17: 45,567,141	V398E	probably damaging	Het
Slc44a5	C	A	3: 154,240,297	L156I	probably benign	Het
Trmt11	G	C	10: 30,547,748	P387R	probably damaging	Het

Other mutations in Pip5k1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Pip5k1c	APN	10	81305711	missense	probably benign	0.45
IGL02274:Pip5k1c	APN	10	81306384	missense	probably damaging	1.00
IGL02500:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02565:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02577:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02579:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02581:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02604:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02610:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02613:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02616:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02617:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02639:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02641:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02642:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02724:Pip5k1c	APN	10	81313462	missense	probably benign	0.01
IGL02751:Pip5k1c	APN	10	81317321	splice site	probably null
PIT4366001:Pip5k1c	UTSW	10	81309008	missense	probably damaging	0.98
R0257:Pip5k1c	UTSW	10	81315096	missense	possibly damaging	0.86
R1643:Pip5k1c	UTSW	10	81314994	missense	probably damaging	1.00
R1663:Pip5k1c	UTSW	10	81312515	missense	probably damaging	1.00
R1872:Pip5k1c	UTSW	10	81306319	missense	probably damaging	0.99
R2295:Pip5k1c	UTSW	10	81305186	missense	probably benign	0.40
R2310:Pip5k1c	UTSW	10	81306308	missense	probably damaging	0.96
R2406:Pip5k1c	UTSW	10	81309024	missense	probably damaging	1.00
R4504:Pip5k1c	UTSW	10	81315111	missense	probably damaging	0.98
R4772:Pip5k1c	UTSW	10	81315940	missense	probably benign
R5022:Pip5k1c	UTSW	10	81310889	splice site	probably null
R5023:Pip5k1c	UTSW	10	81310889	splice site	probably null
R5033:Pip5k1c	UTSW	10	81305250	missense	probably damaging	0.99
R5057:Pip5k1c	UTSW	10	81310889	splice site	probably null
R5482:Pip5k1c	UTSW	10	81293063	missense	probably damaging	0.98
R6305:Pip5k1c	UTSW	10	81315934	missense	probably benign	0.02
R6511:Pip5k1c	UTSW	10	81310817	missense	probably damaging	1.00
R6544:Pip5k1c	UTSW	10	81308996	missense	probably damaging	1.00
R7512:Pip5k1c	UTSW	10	81315119	critical splice donor site	probably null
R7581:Pip5k1c	UTSW	10	81308960	missense	probably damaging	1.00
R8218:Pip5k1c	UTSW	10	81306416	missense	probably damaging	1.00
R8686:Pip5k1c	UTSW	10	81311993	missense	probably damaging	0.99
R8927:Pip5k1c	UTSW	10	81293072	missense	possibly damaging	0.95
R8928:Pip5k1c	UTSW	10	81293072	missense	possibly damaging	0.95
R9048:Pip5k1c	UTSW	10	81316876	intron	probably benign
R9049:Pip5k1c	UTSW	10	81316876	intron	probably benign
R9100:Pip5k1c	UTSW	10	81309222	missense	probably benign	0.01
R9443:Pip5k1c	UTSW	10	81317350	missense	probably damaging	0.99
R9448:Pip5k1c	UTSW	10	81305811	missense	probably damaging	1.00
R9466:Pip5k1c	UTSW	10	81316876	intron	probably benign
R9775:Pip5k1c	UTSW	10	81312019	missense	probably damaging	0.98
R9780:Pip5k1c	UTSW	10	81305196	missense	probably benign	0.01
Z1177:Pip5k1c	UTSW	10	81315032	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- ATCACCCCAGGCTAGGACTC -3'
(R):5'- CGAGACCACAGTGCATTTTC -3'

Sequencing Primer
(F):5'- AGGCTAGGACTCCCTGGGAAC -3'
(R):5'- CTGGCCTTGAACTCACAGAGATTG -3'

Posted On

2014-10-30