Mutagenetix > Incidental Mutations

Incidental Mutation 'R2293:Mdga2'

245083

Institutional Source

Beutler Lab

Gene Symbol

Mdga2

Ensembl Gene

ENSMUSG00000034912

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 2

Synonyms

Adp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2

MMRRC Submission

040292-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2293 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66466060-67222549 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 66568985 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 547 (L547*)

Ref Sequence

ENSEMBL: ENSMUSP00000152613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]

Predicted Effect

probably null
Transcript: ENSMUST00000037181
AA Change: L616*

SMART Domains

Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: L616*

Domain	Start	End	E-Value	Type
IGc2	122	186	1.38e-15	SMART
IG	213	307	1.79e0	SMART
IGc2	324	386	1.56e-14	SMART
IGc2	419	493	4.43e-5	SMART
low complexity region	495	507	N/A	INTRINSIC
IGc2	525	591	1.97e-11	SMART
IG_like	621	687	2.5e0	SMART
Blast:FN3	707	795	4e-40	BLAST
MAM	812	990	3.4e-49	SMART
transmembrane domain	999	1021	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101379

SMART Domains

Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SCOP:d1cs6a1	40	72	2e-5	SMART
Blast:IG	47	72	9e-11	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000178814
AA Change: L606*

SMART Domains

Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: L606*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	53	117	1.38e-15	SMART
IG	144	238	1.79e0	SMART
IGc2	255	317	1.56e-14	SMART
IGc2	350	424	4.43e-5	SMART
low complexity region	426	438	N/A	INTRINSIC
IGc2	456	522	1.97e-11	SMART
IG_like	552	618	2.5e0	SMART
Blast:FN3	638	726	3e-40	BLAST
MAM	736	914	1.38e-49	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000222167
AA Change: L547*

Predicted Effect

probably null
Transcript: ENSMUST00000223141
AA Change: L547*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223289

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano9	T	C	7: 141,102,515	N640S	probably benign	Het
Aox4	T	A	1: 58,221,937	I143N	probably damaging	Het
Arhgef11	C	T	3: 87,727,990	R869C	probably damaging	Het
Bcl6	T	C	16: 23,977,609	N23D	probably damaging	Het
Brca2	T	A	5: 150,560,534	F2939L	possibly damaging	Het
Bsn	C	T	9: 108,113,067	A1829T	possibly damaging	Het
Cyp2j6	T	A	4: 96,529,433	T318S	possibly damaging	Het
Dlg5	A	C	14: 24,158,112	S1009A	probably benign	Het
Dlx6	A	G	6: 6,867,246	Y283C	probably damaging	Het
Dnah10	T	C	5: 124,819,221	Y3550H	probably damaging	Het
Dock7	T	C	4: 98,966,369	S1553G	probably damaging	Het
Ice1	C	A	13: 70,614,957	D193Y	probably damaging	Het
Mgat4a	C	A	1: 37,452,592	R215L	probably damaging	Het
Msantd2	A	G	9: 37,489,804	T69A	probably damaging	Het
Muc5ac	A	G	7: 141,807,199	T1416A	probably damaging	Het
Nup214	T	C	2: 32,026,875	S1181P	probably benign	Het
Pip5k1c	A	G	10: 81,314,084	E42G	possibly damaging	Het
Slc12a5	A	G	2: 164,992,330	E757G	probably benign	Het
Slc16a14	A	T	1: 84,912,843	M247K	probably benign	Het
Slc35b2	T	A	17: 45,567,141	V398E	probably damaging	Het
Slc44a5	C	A	3: 154,240,297	L156I	probably benign	Het
Trmt11	G	C	10: 30,547,748	P387R	probably damaging	Het

Other mutations in Mdga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Mdga2	APN	12	66723109	missense	probably damaging	0.97
IGL01632:Mdga2	APN	12	66629898	splice site	probably benign
IGL01843:Mdga2	APN	12	66723131	critical splice acceptor site	probably null
IGL02230:Mdga2	APN	12	66655423	nonsense	probably null
IGL02348:Mdga2	APN	12	66550575	missense	probably damaging	1.00
IGL02473:Mdga2	APN	12	66550611	missense	possibly damaging	0.73
IGL02795:Mdga2	APN	12	66689432	missense	probably benign	0.00
IGL02901:Mdga2	APN	12	66797809	splice site	probably benign
IGL03373:Mdga2	APN	12	66716722	missense	probably damaging	0.99
PIT4362001:Mdga2	UTSW	12	66797768	missense	possibly damaging	0.83
PIT4377001:Mdga2	UTSW	12	66716695	missense	probably damaging	0.99
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0110:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0218:Mdga2	UTSW	12	66655120	missense	probably damaging	1.00
R0450:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0801:Mdga2	UTSW	12	66486733	missense	probably damaging	1.00
R0847:Mdga2	UTSW	12	66723080	missense	probably damaging	1.00
R1056:Mdga2	UTSW	12	66723120	missense	probably damaging	0.97
R1086:Mdga2	UTSW	12	66506102	splice site	probably benign
R1335:Mdga2	UTSW	12	66716742	splice site	probably null
R1382:Mdga2	UTSW	12	66470916	missense	possibly damaging	0.68
R1490:Mdga2	UTSW	12	66797756	missense	probably benign	0.01
R1521:Mdga2	UTSW	12	66568926	missense	probably benign	0.00
R1556:Mdga2	UTSW	12	66550593	missense	possibly damaging	0.92
R1676:Mdga2	UTSW	12	66568772	missense	probably damaging	1.00
R1676:Mdga2	UTSW	12	66568773	nonsense	probably null
R1698:Mdga2	UTSW	12	66689335	missense	probably damaging	0.97
R1954:Mdga2	UTSW	12	66486708	splice site	probably benign
R2069:Mdga2	UTSW	12	66568917	nonsense	probably null
R2077:Mdga2	UTSW	12	66655362	missense	probably damaging	1.00
R2118:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R2146:Mdga2	UTSW	12	66868741	missense	probably damaging	1.00
R2158:Mdga2	UTSW	12	66689381	missense	possibly damaging	0.64
R2189:Mdga2	UTSW	12	66473196	splice site	probably null
R2886:Mdga2	UTSW	12	66506270	splice site	probably benign
R2960:Mdga2	UTSW	12	66629978	nonsense	probably null
R3937:Mdga2	UTSW	12	67221206	unclassified	probably benign
R4437:Mdga2	UTSW	12	66473198	splice site	probably null
R4514:Mdga2	UTSW	12	66716722	missense	probably damaging	0.99
R4693:Mdga2	UTSW	12	66797633	missense	possibly damaging	0.81
R4719:Mdga2	UTSW	12	66471001	unclassified	probably benign
R4744:Mdga2	UTSW	12	66797727	missense	probably benign	0.01
R4756:Mdga2	UTSW	12	66797653	missense	probably damaging	1.00
R4781:Mdga2	UTSW	12	66797622	splice site	probably null
R5022:Mdga2	UTSW	12	66470760	missense	possibly damaging	0.83
R5108:Mdga2	UTSW	12	66486741	missense	probably benign	0.43
R5479:Mdga2	UTSW	12	66655176	missense	probably damaging	1.00
R5710:Mdga2	UTSW	12	66506782	missense	probably damaging	1.00
R5816:Mdga2	UTSW	12	66655182	missense	probably damaging	1.00
R5822:Mdga2	UTSW	12	66655335	missense	probably damaging	1.00
R5996:Mdga2	UTSW	12	66797763	missense	probably benign	0.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6297:Mdga2	UTSW	12	66506253	missense	probably damaging	1.00
R6484:Mdga2	UTSW	12	66630069	missense	possibly damaging	0.90
R6830:Mdga2	UTSW	12	66723001	missense	probably damaging	1.00
R6912:Mdga2	UTSW	12	66506115	missense	probably benign	0.01
R6971:Mdga2	UTSW	12	66550561	missense	probably damaging	1.00
R7053:Mdga2	UTSW	12	66689384	missense	probably benign	0.41
R7069:Mdga2	UTSW	12	66486752	missense	probably benign	0.31
R7381:Mdga2	UTSW	12	66568896	missense	probably benign	0.44
R7474:Mdga2	UTSW	12	66486761	nonsense	probably null
R7559:Mdga2	UTSW	12	66473229	missense	probably damaging	1.00
R7581:Mdga2	UTSW	12	66506255	missense	probably damaging	0.99
R7596:Mdga2	UTSW	12	66506123	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689350	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689351	missense	possibly damaging	0.63
R7852:Mdga2	UTSW	12	66470950	missense	possibly damaging	0.66
R7935:Mdga2	UTSW	12	66470950	missense	possibly damaging	0.66
R8144:Mdga2	UTSW	12	66655263	missense	probably damaging	1.00
Z1176:Mdga2	UTSW	12	66689443	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGCTGCATCTCCCTGCTC -3'
(R):5'- GGCTCAGTTTAAATATACTCTCCACC -3'

Sequencing Primer
(F):5'- GATGCTGCAGTTATAAACTCCATAG -3'
(R):5'- TTAAAAATACGCCCTCTGCTGG -3'

Posted On

2014-10-30