Mutagenetix > Incidental Mutation

Incidental Mutation 'R2293:Ice1'

245084

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

MMRRC Submission

040292-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R2293 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 70614957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 193 (D193Y)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000222568]

AlphaFold

E9Q286

Predicted Effect

probably damaging
Transcript: ENSMUST00000043493
AA Change: D193Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: D193Y

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222568

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano9	T	C	7: 141,102,515	N640S	probably benign	Het
Aox4	T	A	1: 58,221,937	I143N	probably damaging	Het
Arhgef11	C	T	3: 87,727,990	R869C	probably damaging	Het
Bcl6	T	C	16: 23,977,609	N23D	probably damaging	Het
Brca2	T	A	5: 150,560,534	F2939L	possibly damaging	Het
Bsn	C	T	9: 108,113,067	A1829T	possibly damaging	Het
Cyp2j6	T	A	4: 96,529,433	T318S	possibly damaging	Het
Dlg5	A	C	14: 24,158,112	S1009A	probably benign	Het
Dlx6	A	G	6: 6,867,246	Y283C	probably damaging	Het
Dnah10	T	C	5: 124,819,221	Y3550H	probably damaging	Het
Dock7	T	C	4: 98,966,369	S1553G	probably damaging	Het
Mdga2	A	T	12: 66,568,985	L547*	probably null	Het
Mgat4a	C	A	1: 37,452,592	R215L	probably damaging	Het
Msantd2	A	G	9: 37,489,804	T69A	probably damaging	Het
Muc5ac	A	G	7: 141,807,199	T1416A	probably damaging	Het
Nup214	T	C	2: 32,026,875	S1181P	probably benign	Het
Pip5k1c	A	G	10: 81,314,084	E42G	possibly damaging	Het
Slc12a5	A	G	2: 164,992,330	E757G	probably benign	Het
Slc16a14	A	T	1: 84,912,843	M247K	probably benign	Het
Slc35b2	T	A	17: 45,567,141	V398E	probably damaging	Het
Slc44a5	C	A	3: 154,240,297	L156I	probably benign	Het
Trmt11	G	C	10: 30,547,748	P387R	probably damaging	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1525:Ice1	UTSW	13	70605410	missense	probably benign	0.01
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1603:Ice1	UTSW	13	70603353	missense	probably benign	0.01
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3730:Ice1	UTSW	13	70603240	missense	probably damaging	1.00
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4499:Ice1	UTSW	13	70609027	missense	possibly damaging	0.87
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5078:Ice1	UTSW	13	70604850	missense	probably benign
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6253:Ice1	UTSW	13	70603164	missense	probably damaging	1.00
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6853:Ice1	UTSW	13	70603302	missense	possibly damaging	0.92
R6917:Ice1	UTSW	13	70594894	missense	probably damaging	1.00
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7648:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8474:Ice1	UTSW	13	70604447	missense	probably benign	0.42
R8751:Ice1	UTSW	13	70602891	missense	probably damaging	1.00
R8887:Ice1	UTSW	13	70602931	missense	probably damaging	1.00
R8911:Ice1	UTSW	13	70592668	missense
R8954:Ice1	UTSW	13	70610578	missense	probably damaging	1.00
R9345:Ice1	UTSW	13	70592639	missense
R9438:Ice1	UTSW	13	70606315	missense	probably benign	0.04
R9452:Ice1	UTSW	13	70596343	missense	probably damaging	1.00
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACACTGCTCAGTACCCAGG -3'
(R):5'- TCTGTACAGCATAAGTACTCTTGGG -3'

Sequencing Primer
(F):5'- GGCAGAAACCTATATGTACTTGCTG -3'
(R):5'- CAGCATAAGTACTCTTGGGTTTTC -3'

Posted On

2014-10-30