Incidental Mutation 'R2293:Slc35b2'
ID245087
Institutional Source Beutler Lab
Gene Symbol Slc35b2
Ensembl Gene ENSMUSG00000037089
Gene Namesolute carrier family 35, member B2
SynonymsPAPST1, 1110003M08Rik
MMRRC Submission 040292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R2293 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45563874-45567671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45567141 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 398 (V398E)
Ref Sequence ENSEMBL: ENSMUSP00000153367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000024742] [ENSMUST00000041353] [ENSMUST00000130406] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905] [ENSMUST00000226086]
Predicted Effect probably benign
Transcript: ENSMUST00000024739
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024742
SMART Domains Protein: ENSMUSP00000024742
Gene: ENSMUSG00000023947

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
ANK 122 152 1.14e2 SMART
ANK 157 187 2.15e0 SMART
ANK 190 219 6.81e-3 SMART
ANK 233 262 5.09e-2 SMART
ANK 267 296 1.12e-3 SMART
ANK 300 329 1e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041353
AA Change: V349E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089
AA Change: V349E

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130406
SMART Domains Protein: ENSMUSP00000119678
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 76 2e-32 SMART
PDB:1UYM|A 14 76 7e-38 PDB
Blast:HATPase_c 35 76 3e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151306
Predicted Effect probably benign
Transcript: ENSMUST00000163966
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165127
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166469
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223987
AA Change: V349E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000224341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224559
Predicted Effect probably damaging
Transcript: ENSMUST00000224905
AA Change: V398E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225226
Predicted Effect probably benign
Transcript: ENSMUST00000226086
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferases (e.g., SULT4A1; MIM 608359) use an activated form of sulfate, 3-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS), as a common sulfate donor for sulfation of glycoproteins, proteoglycans, and glycolipids in the endoplasmic reticulum and Golgi apparatus. SLC35B2 is located in the microsomal membrane and transports PAPS from the cytosol, where it is synthesized, into the Golgi lumen (Kamiyama et al., 2003 [PubMed 12716889]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano9 T C 7: 141,102,515 N640S probably benign Het
Aox4 T A 1: 58,221,937 I143N probably damaging Het
Arhgef11 C T 3: 87,727,990 R869C probably damaging Het
Bcl6 T C 16: 23,977,609 N23D probably damaging Het
Brca2 T A 5: 150,560,534 F2939L possibly damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cyp2j6 T A 4: 96,529,433 T318S possibly damaging Het
Dlg5 A C 14: 24,158,112 S1009A probably benign Het
Dlx6 A G 6: 6,867,246 Y283C probably damaging Het
Dnah10 T C 5: 124,819,221 Y3550H probably damaging Het
Dock7 T C 4: 98,966,369 S1553G probably damaging Het
Ice1 C A 13: 70,614,957 D193Y probably damaging Het
Mdga2 A T 12: 66,568,985 L547* probably null Het
Mgat4a C A 1: 37,452,592 R215L probably damaging Het
Msantd2 A G 9: 37,489,804 T69A probably damaging Het
Muc5ac A G 7: 141,807,199 T1416A probably damaging Het
Nup214 T C 2: 32,026,875 S1181P probably benign Het
Pip5k1c A G 10: 81,314,084 E42G possibly damaging Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Slc16a14 A T 1: 84,912,843 M247K probably benign Het
Slc44a5 C A 3: 154,240,297 L156I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Other mutations in Slc35b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Slc35b2 APN 17 45564960 missense probably damaging 0.99
IGL02749:Slc35b2 APN 17 45566567 missense probably benign 0.14
IGL02951:Slc35b2 APN 17 45564768 missense probably damaging 1.00
IGL03382:Slc35b2 APN 17 45566645 missense probably damaging 0.98
R0020:Slc35b2 UTSW 17 45566856 missense probably damaging 1.00
R0368:Slc35b2 UTSW 17 45566463 missense probably benign
R0743:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R0884:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R3894:Slc35b2 UTSW 17 45566442 missense probably benign 0.01
R4372:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4415:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4416:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4417:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R5291:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5314:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5929:Slc35b2 UTSW 17 45566661 missense probably benign 0.35
R6178:Slc35b2 UTSW 17 45566376 missense probably benign 0.10
R7217:Slc35b2 UTSW 17 45565029 missense probably benign 0.19
R7561:Slc35b2 UTSW 17 45566801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAGTTTGCGCTCCATGC -3'
(R):5'- CACAGCTGTCATTTCCATGAAGTG -3'

Sequencing Primer
(F):5'- GTTTGCGCTCCATGCTCTCC -3'
(R):5'- CTCTTAAGGCAAAAGAGGCTGC -3'
Posted On2014-10-30