Incidental Mutation 'R2294:Pik3c2b'
ID 245090
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 040293-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R2294 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 132994513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Histidine at position 159 (P159H)
Ref Sequence ENSEMBL: ENSMUSP00000115469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]
AlphaFold E9QAN8
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: P159H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: P159H

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145153
Predicted Effect probably damaging
Transcript: ENSMUST00000153707
AA Change: P159H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447
AA Change: P159H

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186515
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 C T 15: 98,495,322 (GRCm39) V673I possibly damaging Het
Bsn C T 9: 107,990,266 (GRCm39) A1829T possibly damaging Het
Chchd3 T C 6: 32,829,122 (GRCm39) E166G probably damaging Het
Chrna7 A T 7: 62,760,172 (GRCm39) S135T probably benign Het
Dxo G A 17: 35,057,962 (GRCm39) probably null Het
Fbxw18 A G 9: 109,505,865 (GRCm39) S469P probably damaging Het
G3bp2 G A 5: 92,205,887 (GRCm39) R290C probably damaging Het
Hydin T C 8: 111,026,591 (GRCm39) L103P probably damaging Het
Lrig3 C T 10: 125,802,363 (GRCm39) R7* probably null Het
Lrp6 A G 6: 134,434,705 (GRCm39) C1333R probably damaging Het
Luzp2 T C 7: 54,821,938 (GRCm39) probably benign Het
Lypd8 A T 11: 58,277,680 (GRCm39) N154I probably damaging Het
Ndufs1 A T 1: 63,200,155 (GRCm39) D252E probably damaging Het
Nos3 T A 5: 24,569,855 (GRCm39) V7E probably damaging Het
Or1e33 A G 11: 73,738,312 (GRCm39) L213P probably damaging Het
Osbpl6 A T 2: 76,407,423 (GRCm39) D446V possibly damaging Het
Pkhd1l1 C T 15: 44,343,003 (GRCm39) T160I probably damaging Het
Prelid3a C T 18: 67,605,941 (GRCm39) T16M probably damaging Het
Prl7b1 A T 13: 27,786,854 (GRCm39) M125K possibly damaging Het
Rars1 C A 11: 35,708,363 (GRCm39) probably benign Het
Ripk1 A G 13: 34,200,991 (GRCm39) T235A probably benign Het
Slc38a2 C A 15: 96,589,643 (GRCm39) V363L probably benign Het
Slc6a21 G A 7: 44,929,952 (GRCm39) A147T possibly damaging Het
Tgfb3 T C 12: 86,116,684 (GRCm39) N118S probably benign Het
Tmem175 T C 5: 108,786,525 (GRCm39) probably benign Het
Tmem232 A T 17: 65,757,436 (GRCm39) N252K probably benign Het
Trappc8 G T 18: 20,999,211 (GRCm39) C305* probably null Het
Tyro3 T C 2: 119,636,126 (GRCm39) V223A probably damaging Het
Yipf2 C T 9: 21,501,177 (GRCm39) V74M probably damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCTTGCGTGGTCTTTC -3'
(R):5'- TGCCATCGTAGTCCACAGAC -3'

Sequencing Primer
(F):5'- GGCTCTGATCCCACCCTAAATTAC -3'
(R):5'- ACAGACCCCAGCGTGTGTC -3'
Posted On 2014-10-30