Incidental Mutation 'R2294:G3bp2'
ID 245094
Institutional Source Beutler Lab
Gene Symbol G3bp2
Ensembl Gene ENSMUSG00000029405
Gene Name GTPase activating protein (SH3 domain) binding protein 2
Synonyms G3BP, E430034L04Rik, G3BP2
MMRRC Submission 040293-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2294 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 92052146-92083719 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 92058028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 290 (R290C)
Ref Sequence ENSEMBL: ENSMUSP00000144456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113127] [ENSMUST00000164378] [ENSMUST00000167918] [ENSMUST00000169094] [ENSMUST00000202258]
AlphaFold P97379
Predicted Effect probably damaging
Transcript: ENSMUST00000113127
AA Change: R257C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108752
Gene: ENSMUSG00000029405
AA Change: R257C

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158087
Predicted Effect probably damaging
Transcript: ENSMUST00000164378
AA Change: R290C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128353
Gene: ENSMUSG00000029405
AA Change: R290C

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167918
AA Change: R257C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132469
Gene: ENSMUSG00000029405
AA Change: R257C

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169094
AA Change: R290C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128244
Gene: ENSMUSG00000029405
AA Change: R290C

DomainStartEndE-ValueType
Pfam:NTF2 11 133 1.1e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201824
Predicted Effect probably damaging
Transcript: ENSMUST00000202258
AA Change: R290C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144456
Gene: ENSMUSG00000029405
AA Change: R290C

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202352
Meta Mutation Damage Score 0.2116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 C T 15: 98,597,441 V673I possibly damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Chchd3 T C 6: 32,852,187 E166G probably damaging Het
Chrna7 A T 7: 63,110,424 S135T probably benign Het
Dxo G A 17: 34,838,986 probably null Het
Fbxw18 A G 9: 109,676,797 S469P probably damaging Het
Hydin T C 8: 110,299,959 L103P probably damaging Het
Lrig3 C T 10: 125,966,494 R7* probably null Het
Lrp6 A G 6: 134,457,742 C1333R probably damaging Het
Luzp2 T C 7: 55,172,190 probably benign Het
Lypd8 A T 11: 58,386,854 N154I probably damaging Het
Ndufs1 A T 1: 63,160,996 D252E probably damaging Het
Nos3 T A 5: 24,364,857 V7E probably damaging Het
Olfr393 A G 11: 73,847,486 L213P probably damaging Het
Osbpl6 A T 2: 76,577,079 D446V possibly damaging Het
Pik3c2b C A 1: 133,066,775 P159H probably damaging Het
Pkhd1l1 C T 15: 44,479,607 T160I probably damaging Het
Prelid3a C T 18: 67,472,871 T16M probably damaging Het
Prl7b1 A T 13: 27,602,871 M125K possibly damaging Het
Rars C A 11: 35,817,536 probably benign Het
Ripk1 A G 13: 34,017,008 T235A probably benign Het
Slc38a2 C A 15: 96,691,762 V363L probably benign Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Tgfb3 T C 12: 86,069,910 N118S probably benign Het
Tmem175 T C 5: 108,638,659 probably benign Het
Tmem232 A T 17: 65,450,441 N252K probably benign Het
Trappc8 G T 18: 20,866,154 C305* probably null Het
Tyro3 T C 2: 119,805,645 V223A probably damaging Het
Yipf2 C T 9: 21,589,881 V74M probably damaging Het
Other mutations in G3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:G3bp2 APN 5 92065848 missense probably damaging 0.98
IGL02124:G3bp2 APN 5 92073247 missense possibly damaging 0.92
IGL02519:G3bp2 APN 5 92066524 missense possibly damaging 0.90
IGL03146:G3bp2 APN 5 92066540 missense probably damaging 1.00
IGL03183:G3bp2 APN 5 92055046 missense possibly damaging 0.82
IGL03195:G3bp2 APN 5 92068508 splice site probably benign
IGL03385:G3bp2 APN 5 92068395 missense probably damaging 1.00
R0558:G3bp2 UTSW 5 92073197 missense probably damaging 1.00
R1067:G3bp2 UTSW 5 92063328 splice site probably benign
R1621:G3bp2 UTSW 5 92056278 missense probably damaging 1.00
R3698:G3bp2 UTSW 5 92056280 missense possibly damaging 0.91
R4159:G3bp2 UTSW 5 92064401 missense probably benign 0.00
R4195:G3bp2 UTSW 5 92055416 missense probably damaging 0.99
R4754:G3bp2 UTSW 5 92054909 missense possibly damaging 0.85
R5518:G3bp2 UTSW 5 92068488 missense probably benign 0.00
R5680:G3bp2 UTSW 5 92068360 missense probably damaging 1.00
R5937:G3bp2 UTSW 5 92055397 missense probably damaging 1.00
R8769:G3bp2 UTSW 5 92083497 intron probably benign
R8945:G3bp2 UTSW 5 92068422 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGCAGCATATCCCTATCTAAG -3'
(R):5'- CCCTACAGTCCTAGCTTGGTAC -3'

Sequencing Primer
(F):5'- AGTAATCTGATCTTCACACTCGGAC -3'
(R):5'- CAGTCCTAGCTTGGTACAGAATATCC -3'
Posted On 2014-10-30