Mutagenetix > Incidental Mutation

Incidental Mutation 'R2294:Lrig3'

245105

Institutional Source

Beutler Lab

Gene Symbol

Lrig3

Ensembl Gene

ENSMUSG00000020105

Gene Name

leucine-rich repeats and immunoglobulin-like domains 3

Synonyms

9430095K15Rik, 9030421L11Rik, 9130004I02Rik

MMRRC Submission

040293-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R2294 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125802088-125851228 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 125802363 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 7 (R7*)

Ref Sequence

ENSEMBL: ENSMUSP00000074360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074807]

AlphaFold

Q6P1C6

PDB Structure

Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000074807
AA Change: R7*

SMART Domains

Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: R7*

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	46	78	6.74e-2	SMART
LRR	72	96	4.45e1	SMART
LRR	97	120	1.06e1	SMART
LRR	144	166	1.14e0	SMART
LRR	168	189	1.62e2	SMART
LRR	190	214	1.09e1	SMART
LRR	215	237	1.71e1	SMART
LRR	238	261	2.29e0	SMART
LRR	262	285	3.07e-1	SMART
LRR	286	309	2.49e-1	SMART
LRR	310	333	1.29e1	SMART
LRR	334	357	6.22e0	SMART
LRR	358	384	6.05e0	SMART
LRR_TYP	385	408	1.56e-2	SMART
LRR_TYP	409	432	1.79e-2	SMART
LRRCT	444	494	2.35e-7	SMART
IGc2	511	588	1.65e-4	SMART
IGc2	615	683	1.33e-8	SMART
IGc2	709	774	2.78e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217813

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220332

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (30/30)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy6	C	T	15: 98,495,322 (GRCm39)	V673I	possibly damaging	Het
Bsn	C	T	9: 107,990,266 (GRCm39)	A1829T	possibly damaging	Het
Chchd3	T	C	6: 32,829,122 (GRCm39)	E166G	probably damaging	Het
Chrna7	A	T	7: 62,760,172 (GRCm39)	S135T	probably benign	Het
Dxo	G	A	17: 35,057,962 (GRCm39)		probably null	Het
Fbxw18	A	G	9: 109,505,865 (GRCm39)	S469P	probably damaging	Het
G3bp2	G	A	5: 92,205,887 (GRCm39)	R290C	probably damaging	Het
Hydin	T	C	8: 111,026,591 (GRCm39)	L103P	probably damaging	Het
Lrp6	A	G	6: 134,434,705 (GRCm39)	C1333R	probably damaging	Het
Luzp2	T	C	7: 54,821,938 (GRCm39)		probably benign	Het
Lypd8	A	T	11: 58,277,680 (GRCm39)	N154I	probably damaging	Het
Ndufs1	A	T	1: 63,200,155 (GRCm39)	D252E	probably damaging	Het
Nos3	T	A	5: 24,569,855 (GRCm39)	V7E	probably damaging	Het
Or1e33	A	G	11: 73,738,312 (GRCm39)	L213P	probably damaging	Het
Osbpl6	A	T	2: 76,407,423 (GRCm39)	D446V	possibly damaging	Het
Pik3c2b	C	A	1: 132,994,513 (GRCm39)	P159H	probably damaging	Het
Pkhd1l1	C	T	15: 44,343,003 (GRCm39)	T160I	probably damaging	Het
Prelid3a	C	T	18: 67,605,941 (GRCm39)	T16M	probably damaging	Het
Prl7b1	A	T	13: 27,786,854 (GRCm39)	M125K	possibly damaging	Het
Rars1	C	A	11: 35,708,363 (GRCm39)		probably benign	Het
Ripk1	A	G	13: 34,200,991 (GRCm39)	T235A	probably benign	Het
Slc38a2	C	A	15: 96,589,643 (GRCm39)	V363L	probably benign	Het
Slc6a21	G	A	7: 44,929,952 (GRCm39)	A147T	possibly damaging	Het
Tgfb3	T	C	12: 86,116,684 (GRCm39)	N118S	probably benign	Het
Tmem175	T	C	5: 108,786,525 (GRCm39)		probably benign	Het
Tmem232	A	T	17: 65,757,436 (GRCm39)	N252K	probably benign	Het
Trappc8	G	T	18: 20,999,211 (GRCm39)	C305*	probably null	Het
Tyro3	T	C	2: 119,636,126 (GRCm39)	V223A	probably damaging	Het
Yipf2	C	T	9: 21,501,177 (GRCm39)	V74M	probably damaging	Het

Other mutations in Lrig3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lrig3	APN	10	125,849,017 (GRCm39)	missense	probably benign	0.00
IGL00426:Lrig3	APN	10	125,808,006 (GRCm39)	nonsense	probably null
IGL00969:Lrig3	APN	10	125,832,984 (GRCm39)	missense	probably damaging	1.00
IGL01376:Lrig3	APN	10	125,830,335 (GRCm39)	missense	probably benign	0.01
IGL01510:Lrig3	APN	10	125,844,567 (GRCm39)	missense	probably damaging	1.00
IGL01825:Lrig3	APN	10	125,845,886 (GRCm39)	missense	probably damaging	0.98
IGL02231:Lrig3	APN	10	125,833,041 (GRCm39)	missense	probably damaging	1.00
IGL02377:Lrig3	APN	10	125,850,743 (GRCm39)	missense	probably benign	0.00
IGL02648:Lrig3	APN	10	125,802,463 (GRCm39)	missense	probably benign
IGL02832:Lrig3	APN	10	125,842,871 (GRCm39)	missense	probably benign	0.37
IGL03266:Lrig3	APN	10	125,849,151 (GRCm39)	missense	probably benign	0.28
R0023:Lrig3	UTSW	10	125,846,088 (GRCm39)	missense	probably damaging	1.00
R0129:Lrig3	UTSW	10	125,842,812 (GRCm39)	missense	probably damaging	1.00
R0183:Lrig3	UTSW	10	125,846,061 (GRCm39)	missense	probably damaging	1.00
R0226:Lrig3	UTSW	10	125,807,986 (GRCm39)	splice site	probably benign
R0233:Lrig3	UTSW	10	125,849,395 (GRCm39)	splice site	probably null
R0233:Lrig3	UTSW	10	125,849,395 (GRCm39)	splice site	probably null
R0336:Lrig3	UTSW	10	125,802,574 (GRCm39)	missense	probably benign	0.04
R0348:Lrig3	UTSW	10	125,849,317 (GRCm39)	nonsense	probably null
R0502:Lrig3	UTSW	10	125,844,605 (GRCm39)	missense	probably damaging	1.00
R0639:Lrig3	UTSW	10	125,846,090 (GRCm39)	missense	probably damaging	1.00
R1099:Lrig3	UTSW	10	125,842,883 (GRCm39)	splice site	probably null
R1220:Lrig3	UTSW	10	125,832,945 (GRCm39)	missense	probably damaging	1.00
R1230:Lrig3	UTSW	10	125,838,840 (GRCm39)	missense	probably damaging	1.00
R1398:Lrig3	UTSW	10	125,838,957 (GRCm39)	missense	probably benign	0.00
R1451:Lrig3	UTSW	10	125,845,926 (GRCm39)	missense	possibly damaging	0.92
R1523:Lrig3	UTSW	10	125,844,567 (GRCm39)	missense	probably damaging	1.00
R1545:Lrig3	UTSW	10	125,844,416 (GRCm39)	missense	possibly damaging	0.80
R1661:Lrig3	UTSW	10	125,833,570 (GRCm39)	missense	probably benign	0.12
R1665:Lrig3	UTSW	10	125,833,570 (GRCm39)	missense	probably benign	0.12
R1673:Lrig3	UTSW	10	125,846,036 (GRCm39)	missense	probably damaging	1.00
R1778:Lrig3	UTSW	10	125,845,944 (GRCm39)	missense	probably damaging	1.00
R1800:Lrig3	UTSW	10	125,832,920 (GRCm39)	splice site	probably null
R1840:Lrig3	UTSW	10	125,849,258 (GRCm39)	nonsense	probably null
R1882:Lrig3	UTSW	10	125,845,694 (GRCm39)	missense	possibly damaging	0.89
R1900:Lrig3	UTSW	10	125,838,262 (GRCm39)	splice site	probably benign
R2160:Lrig3	UTSW	10	125,833,565 (GRCm39)	missense	possibly damaging	0.95
R2200:Lrig3	UTSW	10	125,832,478 (GRCm39)	splice site	probably null
R2518:Lrig3	UTSW	10	125,830,310 (GRCm39)	missense	probably benign	0.07
R3037:Lrig3	UTSW	10	125,845,901 (GRCm39)	missense	probably damaging	1.00
R3236:Lrig3	UTSW	10	125,833,056 (GRCm39)	missense	probably damaging	1.00
R4073:Lrig3	UTSW	10	125,849,277 (GRCm39)	missense	probably benign
R4074:Lrig3	UTSW	10	125,849,277 (GRCm39)	missense	probably benign
R4075:Lrig3	UTSW	10	125,849,277 (GRCm39)	missense	probably benign
R4077:Lrig3	UTSW	10	125,845,656 (GRCm39)	missense	probably damaging	1.00
R4079:Lrig3	UTSW	10	125,845,656 (GRCm39)	missense	probably damaging	1.00
R4405:Lrig3	UTSW	10	125,846,877 (GRCm39)	missense	probably benign	0.00
R4425:Lrig3	UTSW	10	125,849,273 (GRCm39)	missense	probably benign	0.00
R4505:Lrig3	UTSW	10	125,849,216 (GRCm39)	missense	probably benign	0.00
R4860:Lrig3	UTSW	10	125,846,921 (GRCm39)	missense	probably benign	0.36
R4860:Lrig3	UTSW	10	125,846,921 (GRCm39)	missense	probably benign	0.36
R4903:Lrig3	UTSW	10	125,832,482 (GRCm39)	critical splice acceptor site	probably null
R5201:Lrig3	UTSW	10	125,849,020 (GRCm39)	missense	possibly damaging	0.48
R5307:Lrig3	UTSW	10	125,842,559 (GRCm39)	missense	probably damaging	1.00
R5402:Lrig3	UTSW	10	125,844,609 (GRCm39)	missense	probably damaging	1.00
R5557:Lrig3	UTSW	10	125,808,003 (GRCm39)	missense	probably damaging	1.00
R5792:Lrig3	UTSW	10	125,845,788 (GRCm39)	missense	probably damaging	1.00
R5903:Lrig3	UTSW	10	125,844,347 (GRCm39)	missense	probably damaging	1.00
R6280:Lrig3	UTSW	10	125,846,848 (GRCm39)	missense	probably benign	0.18
R6484:Lrig3	UTSW	10	125,832,478 (GRCm39)	splice site	probably null
R6985:Lrig3	UTSW	10	125,850,738 (GRCm39)	missense	possibly damaging	0.64
R7089:Lrig3	UTSW	10	125,832,993 (GRCm39)	missense	probably damaging	1.00
R7177:Lrig3	UTSW	10	125,842,712 (GRCm39)	missense	probably benign	0.02
R7347:Lrig3	UTSW	10	125,845,835 (GRCm39)	missense	probably damaging	1.00
R9093:Lrig3	UTSW	10	125,845,950 (GRCm39)	missense	possibly damaging	0.51
R9188:Lrig3	UTSW	10	125,838,935 (GRCm39)	missense	possibly damaging	0.80
R9295:Lrig3	UTSW	10	125,850,722 (GRCm39)	missense	probably benign	0.00
R9378:Lrig3	UTSW	10	125,832,953 (GRCm39)	missense	probably damaging	0.98
R9526:Lrig3	UTSW	10	125,850,736 (GRCm39)	missense	probably benign
R9567:Lrig3	UTSW	10	125,845,964 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGTTTCTCGGCGTGCCATC -3'
(R):5'- GATACTGATACTCACAGCCGTG -3'

Sequencing Primer
(F):5'- TGCCTTCACCGTGGCTG -3'
(R):5'- ACAGCCGTGTGACCCAG -3'

Posted On

2014-10-30