Incidental Mutation 'R2294:Rars'
ID245106
Institutional Source Beutler Lab
Gene Symbol Rars
Ensembl Gene ENSMUSG00000018848
Gene Namearginyl-tRNA synthetase
Synonyms
MMRRC Submission 040293-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R2294 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location35808381-35834506 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 35817536 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000018992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018992]
Predicted Effect probably benign
Transcript: ENSMUST00000018992
SMART Domains Protein: ENSMUSP00000018992
Gene: ENSMUSG00000018848

DomainStartEndE-ValueType
Blast:Arg_tRNA_synt_N 16 60 6e-13 BLAST
Arg_tRNA_synt_N 78 166 1.6e-27 SMART
Pfam:tRNA-synt_1d 174 520 1.2e-164 PFAM
DALR_1 534 660 3.12e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166122
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 C T 15: 98,597,441 V673I possibly damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Chchd3 T C 6: 32,852,187 E166G probably damaging Het
Chrna7 A T 7: 63,110,424 S135T probably benign Het
Dxo G A 17: 34,838,986 probably null Het
Fbxw18 A G 9: 109,676,797 S469P probably damaging Het
G3bp2 G A 5: 92,058,028 R290C probably damaging Het
Hydin T C 8: 110,299,959 L103P probably damaging Het
Lrig3 C T 10: 125,966,494 R7* probably null Het
Lrp6 A G 6: 134,457,742 C1333R probably damaging Het
Luzp2 T C 7: 55,172,190 probably benign Het
Lypd8 A T 11: 58,386,854 N154I probably damaging Het
Ndufs1 A T 1: 63,160,996 D252E probably damaging Het
Nos3 T A 5: 24,364,857 V7E probably damaging Het
Olfr393 A G 11: 73,847,486 L213P probably damaging Het
Osbpl6 A T 2: 76,577,079 D446V possibly damaging Het
Pik3c2b C A 1: 133,066,775 P159H probably damaging Het
Pkhd1l1 C T 15: 44,479,607 T160I probably damaging Het
Prelid3a C T 18: 67,472,871 T16M probably damaging Het
Prl7b1 A T 13: 27,602,871 M125K possibly damaging Het
Ripk1 A G 13: 34,017,008 T235A probably benign Het
Slc38a2 C A 15: 96,691,762 V363L probably benign Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Tgfb3 T C 12: 86,069,910 N118S probably benign Het
Tmem175 T C 5: 108,638,659 probably benign Het
Tmem232 A T 17: 65,450,441 N252K probably benign Het
Trappc8 G T 18: 20,866,154 C305* probably null Het
Tyro3 T C 2: 119,805,645 V223A probably damaging Het
Yipf2 C T 9: 21,589,881 V74M probably damaging Het
Other mutations in Rars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Rars APN 11 35825981 splice site probably benign
IGL01672:Rars APN 11 35808553 missense probably damaging 0.99
IGL01721:Rars APN 11 35828664 missense probably damaging 1.00
IGL01887:Rars APN 11 35825995 missense probably benign 0.03
IGL02605:Rars APN 11 35824526 splice site probably benign
IGL03296:Rars APN 11 35816696 nonsense probably null
IGL03354:Rars APN 11 35824475 missense probably damaging 1.00
R0410:Rars UTSW 11 35826020 missense probably damaging 1.00
R1193:Rars UTSW 11 35809326 missense possibly damaging 0.92
R1222:Rars UTSW 11 35809740 missense probably damaging 1.00
R1418:Rars UTSW 11 35809740 missense probably damaging 1.00
R1562:Rars UTSW 11 35821094 critical splice donor site probably null
R1768:Rars UTSW 11 35809638 missense probably damaging 1.00
R1800:Rars UTSW 11 35825995 missense probably benign 0.03
R2055:Rars UTSW 11 35826583 splice site probably benign
R4281:Rars UTSW 11 35821224 missense probably damaging 1.00
R4807:Rars UTSW 11 35809146 missense possibly damaging 0.81
R4898:Rars UTSW 11 35808558 missense probably damaging 1.00
R5522:Rars UTSW 11 35817368 nonsense probably null
R5907:Rars UTSW 11 35828648 missense probably damaging 1.00
R6243:Rars UTSW 11 35826547 missense possibly damaging 0.64
R6289:Rars UTSW 11 35826067 missense probably damaging 1.00
R6550:Rars UTSW 11 35833183 missense probably benign 0.00
R6889:Rars UTSW 11 35808486 missense probably damaging 1.00
R7260:Rars UTSW 11 35834454 missense probably benign 0.00
R7682:Rars UTSW 11 35828752 missense probably benign 0.00
R7808:Rars UTSW 11 35828707 missense probably benign
R7822:Rars UTSW 11 35819966 missense probably damaging 0.99
R7856:Rars UTSW 11 35808585 missense probably benign 0.09
R8029:Rars UTSW 11 35821165 missense probably damaging 1.00
Z1177:Rars UTSW 11 35826109 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTGCAATGGGGCTTTAGTC -3'
(R):5'- GTACATGAACTGCCCACGTTC -3'

Sequencing Primer
(F):5'- ATGGGGCTTTAGTCAAACCC -3'
(R):5'- ACGTTCTCTCGTACACCTAAAGG -3'
Posted On2014-10-30