Incidental Mutation 'R2294:Tgfb3'
ID 245110
Institutional Source Beutler Lab
Gene Symbol Tgfb3
Ensembl Gene ENSMUSG00000021253
Gene Name transforming growth factor, beta 3
Synonyms Tgfb-3
MMRRC Submission 040293-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2294 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 86103519-86125815 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86116684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 118 (N118S)
Ref Sequence ENSEMBL: ENSMUSP00000003687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003687]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000003687
AA Change: N118S

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003687
Gene: ENSMUSG00000021253
AA Change: N118S

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
Pfam:TGFb_propeptide 23 281 2.7e-38 PFAM
TGFB 315 412 5.35e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192206
Meta Mutation Damage Score 0.1073 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This protein is involved in embryogenesis and cell differentiation, and may play a role in wound healing. Homozygous knockout mice for this gene exhibit cleft palate, delayed pulmonary development and neonatal death. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cleft palate, lung hypoplasia, hemothorax, impaired suckling, respiratory distress, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 C T 15: 98,495,322 (GRCm39) V673I possibly damaging Het
Bsn C T 9: 107,990,266 (GRCm39) A1829T possibly damaging Het
Chchd3 T C 6: 32,829,122 (GRCm39) E166G probably damaging Het
Chrna7 A T 7: 62,760,172 (GRCm39) S135T probably benign Het
Dxo G A 17: 35,057,962 (GRCm39) probably null Het
Fbxw18 A G 9: 109,505,865 (GRCm39) S469P probably damaging Het
G3bp2 G A 5: 92,205,887 (GRCm39) R290C probably damaging Het
Hydin T C 8: 111,026,591 (GRCm39) L103P probably damaging Het
Lrig3 C T 10: 125,802,363 (GRCm39) R7* probably null Het
Lrp6 A G 6: 134,434,705 (GRCm39) C1333R probably damaging Het
Luzp2 T C 7: 54,821,938 (GRCm39) probably benign Het
Lypd8 A T 11: 58,277,680 (GRCm39) N154I probably damaging Het
Ndufs1 A T 1: 63,200,155 (GRCm39) D252E probably damaging Het
Nos3 T A 5: 24,569,855 (GRCm39) V7E probably damaging Het
Or1e33 A G 11: 73,738,312 (GRCm39) L213P probably damaging Het
Osbpl6 A T 2: 76,407,423 (GRCm39) D446V possibly damaging Het
Pik3c2b C A 1: 132,994,513 (GRCm39) P159H probably damaging Het
Pkhd1l1 C T 15: 44,343,003 (GRCm39) T160I probably damaging Het
Prelid3a C T 18: 67,605,941 (GRCm39) T16M probably damaging Het
Prl7b1 A T 13: 27,786,854 (GRCm39) M125K possibly damaging Het
Rars1 C A 11: 35,708,363 (GRCm39) probably benign Het
Ripk1 A G 13: 34,200,991 (GRCm39) T235A probably benign Het
Slc38a2 C A 15: 96,589,643 (GRCm39) V363L probably benign Het
Slc6a21 G A 7: 44,929,952 (GRCm39) A147T possibly damaging Het
Tmem175 T C 5: 108,786,525 (GRCm39) probably benign Het
Tmem232 A T 17: 65,757,436 (GRCm39) N252K probably benign Het
Trappc8 G T 18: 20,999,211 (GRCm39) C305* probably null Het
Tyro3 T C 2: 119,636,126 (GRCm39) V223A probably damaging Het
Yipf2 C T 9: 21,501,177 (GRCm39) V74M probably damaging Het
Other mutations in Tgfb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02609:Tgfb3 APN 12 86,124,613 (GRCm39) missense probably benign
IGL02899:Tgfb3 APN 12 86,116,550 (GRCm39) missense probably damaging 1.00
IGL03276:Tgfb3 APN 12 86,104,642 (GRCm39) missense probably damaging 0.99
R0050:Tgfb3 UTSW 12 86,116,658 (GRCm39) missense possibly damaging 0.85
R0053:Tgfb3 UTSW 12 86,124,603 (GRCm39) missense probably damaging 1.00
R0053:Tgfb3 UTSW 12 86,124,603 (GRCm39) missense probably damaging 1.00
R0976:Tgfb3 UTSW 12 86,116,606 (GRCm39) missense probably damaging 1.00
R1460:Tgfb3 UTSW 12 86,105,841 (GRCm39) intron probably benign
R1474:Tgfb3 UTSW 12 86,116,120 (GRCm39) critical splice donor site probably null
R1686:Tgfb3 UTSW 12 86,116,517 (GRCm39) splice site probably benign
R1826:Tgfb3 UTSW 12 86,108,818 (GRCm39) missense probably benign 0.04
R2105:Tgfb3 UTSW 12 86,116,543 (GRCm39) missense possibly damaging 0.91
R3159:Tgfb3 UTSW 12 86,105,760 (GRCm39) missense probably damaging 1.00
R4590:Tgfb3 UTSW 12 86,124,589 (GRCm39) missense possibly damaging 0.59
R4866:Tgfb3 UTSW 12 86,124,588 (GRCm39) missense possibly damaging 0.95
R4868:Tgfb3 UTSW 12 86,108,955 (GRCm39) missense probably benign 0.02
R5104:Tgfb3 UTSW 12 86,105,756 (GRCm39) missense possibly damaging 0.94
R6030:Tgfb3 UTSW 12 86,110,624 (GRCm39) missense probably benign 0.03
R6030:Tgfb3 UTSW 12 86,110,624 (GRCm39) missense probably benign 0.03
R6213:Tgfb3 UTSW 12 86,104,621 (GRCm39) missense probably damaging 1.00
R6257:Tgfb3 UTSW 12 86,124,615 (GRCm39) missense possibly damaging 0.94
R6331:Tgfb3 UTSW 12 86,110,638 (GRCm39) missense probably benign 0.03
R6762:Tgfb3 UTSW 12 86,116,237 (GRCm39) missense probably benign 0.00
R7473:Tgfb3 UTSW 12 86,108,923 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGTTTCCAGCCAGAAGGAATAC -3'
(R):5'- CAGTCCCAGTTATGTGTCCTG -3'

Sequencing Primer
(F):5'- ACCTGGAAGAGCTCAATTCTCTG -3'
(R):5'- GACTCTCTATGACTCTGGGGTCAC -3'
Posted On 2014-10-30