Incidental Mutation 'R2294:Prl7b1'
ID245112
Institutional Source Beutler Lab
Gene Symbol Prl7b1
Ensembl Gene ENSMUSG00000021347
Gene Nameprolactin family 7, subfamily b, member 1
SynonymsPLP-N, Prlpn, 1600014J19Rik
MMRRC Submission 040293-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2294 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location27601819-27610582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27602871 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 125 (M125K)
Ref Sequence ENSEMBL: ENSMUSP00000079431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080595]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080595
AA Change: M125K

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079431
Gene: ENSMUSG00000021347
AA Change: M125K

DomainStartEndE-ValueType
Pfam:Hormone_1 16 241 3.1e-60 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced fetal growth and survival following exposure of dams to low oxygen conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 C T 15: 98,597,441 V673I possibly damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Chchd3 T C 6: 32,852,187 E166G probably damaging Het
Chrna7 A T 7: 63,110,424 S135T probably benign Het
Dxo G A 17: 34,838,986 probably null Het
Fbxw18 A G 9: 109,676,797 S469P probably damaging Het
G3bp2 G A 5: 92,058,028 R290C probably damaging Het
Hydin T C 8: 110,299,959 L103P probably damaging Het
Lrig3 C T 10: 125,966,494 R7* probably null Het
Lrp6 A G 6: 134,457,742 C1333R probably damaging Het
Luzp2 T C 7: 55,172,190 probably benign Het
Lypd8 A T 11: 58,386,854 N154I probably damaging Het
Ndufs1 A T 1: 63,160,996 D252E probably damaging Het
Nos3 T A 5: 24,364,857 V7E probably damaging Het
Olfr393 A G 11: 73,847,486 L213P probably damaging Het
Osbpl6 A T 2: 76,577,079 D446V possibly damaging Het
Pik3c2b C A 1: 133,066,775 P159H probably damaging Het
Pkhd1l1 C T 15: 44,479,607 T160I probably damaging Het
Prelid3a C T 18: 67,472,871 T16M probably damaging Het
Rars C A 11: 35,817,536 probably benign Het
Ripk1 A G 13: 34,017,008 T235A probably benign Het
Slc38a2 C A 15: 96,691,762 V363L probably benign Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Tgfb3 T C 12: 86,069,910 N118S probably benign Het
Tmem175 T C 5: 108,638,659 probably benign Het
Tmem232 A T 17: 65,450,441 N252K probably benign Het
Trappc8 G T 18: 20,866,154 C305* probably null Het
Tyro3 T C 2: 119,805,645 V223A probably damaging Het
Yipf2 C T 9: 21,589,881 V74M probably damaging Het
Other mutations in Prl7b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Prl7b1 APN 13 27604590 missense probably damaging 0.98
IGL01350:Prl7b1 APN 13 27602821 missense probably damaging 1.00
IGL01602:Prl7b1 APN 13 27602044 missense possibly damaging 0.70
IGL01605:Prl7b1 APN 13 27602044 missense possibly damaging 0.70
IGL03106:Prl7b1 APN 13 27606935 missense probably benign 0.17
IGL03401:Prl7b1 APN 13 27601981 missense probably benign 0.02
fleshy UTSW 13 27602895 splice site probably null
R1169:Prl7b1 UTSW 13 27606904 missense possibly damaging 0.81
R1423:Prl7b1 UTSW 13 27602127 missense probably damaging 0.99
R1846:Prl7b1 UTSW 13 27602848 missense probably damaging 1.00
R6049:Prl7b1 UTSW 13 27606178 missense probably benign 0.03
R6065:Prl7b1 UTSW 13 27604546 missense probably benign 0.01
R6324:Prl7b1 UTSW 13 27602895 splice site probably null
R6870:Prl7b1 UTSW 13 27604533 missense probably damaging 1.00
R7473:Prl7b1 UTSW 13 27602013 missense possibly damaging 0.70
R7742:Prl7b1 UTSW 13 27607048 missense probably benign 0.07
R8301:Prl7b1 UTSW 13 27602772 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CAGCTCTATCCCTTAGTGGCAAG -3'
(R):5'- TGCAGGAGAGTGGCTGAAATTC -3'

Sequencing Primer
(F):5'- GTGGAAAGTAAGAATATGTCTCACC -3'
(R):5'- GGAGAGTGGCTGAAATTCTATAACTC -3'
Posted On2014-10-30