Incidental Mutation 'R2294:Tmem232'
ID245119
Institutional Source Beutler Lab
Gene Symbol Tmem232
Ensembl Gene ENSMUSG00000045036
Gene Nametransmembrane protein 232
SynonymsLOC381107, E130009J12Rik
MMRRC Submission 040293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2294 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location65256005-65540782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65450441 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 252 (N252K)
Ref Sequence ENSEMBL: ENSMUSP00000083927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062161] [ENSMUST00000086722]
Predicted Effect probably benign
Transcript: ENSMUST00000062161
AA Change: N252K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055652
Gene: ENSMUSG00000045036
AA Change: N252K

DomainStartEndE-ValueType
Pfam:TMEM232 40 488 5.3e-235 PFAM
coiled coil region 598 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086722
AA Change: N252K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000083927
Gene: ENSMUSG00000045036
AA Change: N252K

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
coiled coil region 598 634 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 C T 15: 98,597,441 V673I possibly damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Chchd3 T C 6: 32,852,187 E166G probably damaging Het
Chrna7 A T 7: 63,110,424 S135T probably benign Het
Dxo G A 17: 34,838,986 probably null Het
Fbxw18 A G 9: 109,676,797 S469P probably damaging Het
G3bp2 G A 5: 92,058,028 R290C probably damaging Het
Hydin T C 8: 110,299,959 L103P probably damaging Het
Lrig3 C T 10: 125,966,494 R7* probably null Het
Lrp6 A G 6: 134,457,742 C1333R probably damaging Het
Luzp2 T C 7: 55,172,190 probably benign Het
Lypd8 A T 11: 58,386,854 N154I probably damaging Het
Ndufs1 A T 1: 63,160,996 D252E probably damaging Het
Nos3 T A 5: 24,364,857 V7E probably damaging Het
Olfr393 A G 11: 73,847,486 L213P probably damaging Het
Osbpl6 A T 2: 76,577,079 D446V possibly damaging Het
Pik3c2b C A 1: 133,066,775 P159H probably damaging Het
Pkhd1l1 C T 15: 44,479,607 T160I probably damaging Het
Prelid3a C T 18: 67,472,871 T16M probably damaging Het
Prl7b1 A T 13: 27,602,871 M125K possibly damaging Het
Rars C A 11: 35,817,536 probably benign Het
Ripk1 A G 13: 34,017,008 T235A probably benign Het
Slc38a2 C A 15: 96,691,762 V363L probably benign Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Tgfb3 T C 12: 86,069,910 N118S probably benign Het
Tmem175 T C 5: 108,638,659 probably benign Het
Trappc8 G T 18: 20,866,154 C305* probably null Het
Tyro3 T C 2: 119,805,645 V223A probably damaging Het
Yipf2 C T 9: 21,589,881 V74M probably damaging Het
Other mutations in Tmem232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Tmem232 APN 17 65256574 missense possibly damaging 0.71
IGL00954:Tmem232 APN 17 65500153 missense probably damaging 1.00
IGL01530:Tmem232 APN 17 65256548 nonsense probably null
IGL02881:Tmem232 APN 17 65450370 missense probably damaging 1.00
IGL02969:Tmem232 APN 17 65256563 missense possibly damaging 0.69
IGL02972:Tmem232 APN 17 65476673 missense probably benign 0.00
IGL03028:Tmem232 APN 17 65256389 missense probably benign 0.14
IGL03293:Tmem232 APN 17 65450374 missense probably damaging 1.00
R0380:Tmem232 UTSW 17 65256448 missense probably benign 0.23
R0432:Tmem232 UTSW 17 65256503 missense probably damaging 0.99
R0524:Tmem232 UTSW 17 65485942 missense probably damaging 0.98
R0548:Tmem232 UTSW 17 65382620 missense probably benign 0.22
R1345:Tmem232 UTSW 17 65450406 missense possibly damaging 0.60
R1521:Tmem232 UTSW 17 65484501 missense probably damaging 0.99
R1954:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R1955:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R2012:Tmem232 UTSW 17 65500172 missense probably benign 0.21
R2369:Tmem232 UTSW 17 65402997 missense probably damaging 1.00
R2384:Tmem232 UTSW 17 65402857 missense probably damaging 1.00
R2894:Tmem232 UTSW 17 65450413 missense probably damaging 1.00
R3431:Tmem232 UTSW 17 65265302 splice site probably null
R3788:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R3789:Tmem232 UTSW 17 65382525 missense probably benign 0.02
R3789:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R4155:Tmem232 UTSW 17 65436333 missense probably damaging 0.97
R4691:Tmem232 UTSW 17 65265242 missense possibly damaging 0.88
R4838:Tmem232 UTSW 17 65430888 missense probably benign 0.04
R5340:Tmem232 UTSW 17 65402998 missense possibly damaging 0.92
R5619:Tmem232 UTSW 17 65486511 missense probably benign 0.06
R6176:Tmem232 UTSW 17 65485872 missense probably damaging 1.00
R6192:Tmem232 UTSW 17 65430805 missense probably damaging 1.00
R6223:Tmem232 UTSW 17 65500196 start codon destroyed probably null 0.99
R6256:Tmem232 UTSW 17 65478402 missense possibly damaging 0.89
R6782:Tmem232 UTSW 17 65500124 missense possibly damaging 0.88
R6856:Tmem232 UTSW 17 65450310 missense possibly damaging 0.57
R7262:Tmem232 UTSW 17 65500117 missense probably benign
R7459:Tmem232 UTSW 17 65256389 missense probably benign 0.14
R7699:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R7700:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R8284:Tmem232 UTSW 17 65402995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCGGGCACTAAGGTCTCC -3'
(R):5'- GATACATTGAACACAGGGACTTG -3'

Sequencing Primer
(F):5'- ACTAAGGTCTCCTGGAGTCAC -3'
(R):5'- CATTGAACACAGGGACTTGTAAAC -3'
Posted On2014-10-30