Incidental Mutation 'R0279:Atp2b4'
ID24512
Institutional Source Beutler Lab
Gene Symbol Atp2b4
Ensembl Gene ENSMUSG00000026463
Gene NameATPase, Ca++ transporting, plasma membrane 4
SynonymsPMCA4
MMRRC Submission 038501-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R0279 (G1)
Quality Score174
Status Validated
Chromosome1
Chromosomal Location133699457-133801041 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 133729702 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048953] [ENSMUST00000112264] [ENSMUST00000125659] [ENSMUST00000143567] [ENSMUST00000165602]
Predicted Effect probably benign
Transcript: ENSMUST00000048953
SMART Domains Protein: ENSMUSP00000047978
Gene: ENSMUSG00000026463

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.7e-58 PFAM
Pfam:Hydrolase 460 798 3e-26 PFAM
Pfam:HAD 463 795 7.4e-15 PFAM
Pfam:Hydrolase_like2 510 605 3.6e-17 PFAM
Pfam:Hydrolase_3 756 831 2.7e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1153 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112264
SMART Domains Protein: ENSMUSP00000107883
Gene: ENSMUSG00000026463

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.3e-58 PFAM
Pfam:Hydrolase 460 798 1.2e-26 PFAM
Pfam:HAD 463 795 3.5e-15 PFAM
Pfam:Hydrolase_like2 510 605 4.6e-17 PFAM
Pfam:Hydrolase_3 756 831 9.1e-7 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1104 7.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125659
SMART Domains Protein: ENSMUSP00000116941
Gene: ENSMUSG00000026463

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.7e-58 PFAM
Pfam:Hydrolase 460 798 3e-26 PFAM
Pfam:HAD 463 795 7.4e-15 PFAM
Pfam:Hydrolase_like2 510 605 3.6e-17 PFAM
Pfam:Hydrolase_3 756 831 2.7e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.1e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1153 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143567
SMART Domains Protein: ENSMUSP00000119242
Gene: ENSMUSG00000026463

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 153 301 6.8e-29 PFAM
Pfam:E1-E2_ATPase 338 455 1.9e-13 PFAM
Pfam:HAD 463 795 1e-21 PFAM
Pfam:Cation_ATPase 509 605 5.8e-17 PFAM
Pfam:Hydrolase 577 798 5e-15 PFAM
Pfam:Hydrolase_3 756 831 6.6e-7 PFAM
Pfam:Cation_ATPase_C 868 1050 4.5e-45 PFAM
Pfam:ATP_Ca_trans_C 1090 1141 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165602
SMART Domains Protein: ENSMUSP00000133187
Gene: ENSMUSG00000026463

DomainStartEndE-ValueType
Cation_ATPase_N 45 121 1.81e-8 SMART
low complexity region 140 152 N/A INTRINSIC
Pfam:E1-E2_ATPase 154 456 1.5e-58 PFAM
Pfam:Hydrolase 460 798 1.4e-26 PFAM
Pfam:HAD 463 795 4.1e-15 PFAM
Pfam:Hydrolase_like2 510 605 5.1e-17 PFAM
Pfam:Hydrolase_3 756 831 1e-6 PFAM
Pfam:Cation_ATPase_C 868 1050 1.3e-43 PFAM
Pfam:ATP_Ca_trans_C 1090 1151 4.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183597
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 4. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility with impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610528J11Rik A T 4: 118,529,293 M1L probably benign Het
5730596B20Rik T A 6: 52,179,202 probably benign Het
Acrbp T C 6: 125,053,954 probably null Het
Acss3 A G 10: 107,084,871 I126T possibly damaging Het
Aff3 T C 1: 38,535,569 E110G probably damaging Het
Aldh1a3 T C 7: 66,409,252 I113V probably benign Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Atp8a1 C T 5: 67,813,092 probably null Het
Bhmt A G 13: 93,625,464 C104R probably damaging Het
Ccdc151 A G 9: 21,990,247 probably benign Het
Cct5 T G 15: 31,591,031 E508A probably damaging Het
Celsr1 T A 15: 85,902,864 E2761D probably benign Het
Clstn1 T C 4: 149,643,674 S600P probably damaging Het
Cnppd1 A G 1: 75,136,929 S232P probably damaging Het
Crybb3 T C 5: 113,079,753 probably null Het
Csmd1 A G 8: 16,223,235 I861T probably damaging Het
Cyp2d10 A C 15: 82,405,339 S191A possibly damaging Het
Ddx10 T C 9: 53,235,304 D206G probably damaging Het
Dnah1 G T 14: 31,302,375 H916N possibly damaging Het
Dnah9 A G 11: 65,911,789 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Etnppl A G 3: 130,629,413 R248G probably damaging Het
Eya3 T C 4: 132,719,247 F369L probably damaging Het
Fam129a T C 1: 151,709,206 probably null Het
Fam170b T C 14: 32,834,068 probably benign Het
Fli1 A T 9: 32,461,427 V105D probably damaging Het
Fmo1 T C 1: 162,830,272 I433M possibly damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Foxe3 T C 4: 114,925,568 D149G probably damaging Het
Gk5 T C 9: 96,174,804 probably benign Het
Gm14226 A G 2: 155,025,452 D443G possibly damaging Het
Gm9796 C T 11: 95,697,995 noncoding transcript Het
Golga4 A T 9: 118,568,993 R52S probably benign Het
Hey2 C A 10: 30,834,010 C249F probably damaging Het
Ipo9 A T 1: 135,420,363 probably benign Het
Ireb2 C A 9: 54,886,593 T269K probably benign Het
Kansl3 A G 1: 36,351,969 V274A probably damaging Het
Kcnk2 C T 1: 189,209,972 A352T possibly damaging Het
Lamc2 T C 1: 153,130,696 E903G probably benign Het
Lepr A G 4: 101,750,344 K253R probably benign Het
Lmntd2 T C 7: 141,213,623 probably benign Het
Lrrc39 A T 3: 116,578,303 T240S probably benign Het
Lrrc43 A G 5: 123,497,022 probably null Het
Maf T C 8: 115,705,756 M370V possibly damaging Het
Mib2 G A 4: 155,661,216 S46L possibly damaging Het
Mms22l C T 4: 24,497,867 T63I probably damaging Het
Morc2a T A 11: 3,683,989 S700R probably benign Het
Mpz A G 1: 171,159,929 probably benign Het
Ncam2 T C 16: 81,623,337 probably benign Het
Nudt14 C T 12: 112,938,417 A123T probably damaging Het
Olfr1016 A T 2: 85,799,535 I245N possibly damaging Het
Olfr13 G A 6: 43,174,758 M257I probably benign Het
Olfr239 C T 17: 33,199,324 T92I probably benign Het
Otoa T C 7: 121,111,079 probably benign Het
Pik3cg G A 12: 32,204,791 T399I probably damaging Het
Pkn3 C T 2: 30,083,297 A377V probably benign Het
Ppan A G 9: 20,891,529 N327S probably benign Het
Prkca T C 11: 108,054,111 probably benign Het
Prrc2c A T 1: 162,715,464 V320E probably damaging Het
Ptprq A G 10: 107,608,417 V1442A probably damaging Het
Rapgef1 C T 2: 29,726,227 R834C probably damaging Het
Rbms1 G T 2: 60,842,410 N44K probably damaging Het
Rfwd3 A C 8: 111,282,733 F404V probably benign Het
Rimbp3 G T 16: 17,209,453 R247L probably benign Het
Serpinb1b T C 13: 33,093,713 S310P possibly damaging Het
Smtn C A 11: 3,530,235 V329L probably damaging Het
Snapc2 T C 8: 4,254,979 probably benign Het
Spam1 A T 6: 24,800,419 M386L probably benign Het
Syne2 A G 12: 76,095,613 E6208G probably damaging Het
Teddm1a T C 1: 153,892,623 Y278H probably damaging Het
Tnfaip6 A T 2: 52,055,916 N258I possibly damaging Het
Trpm4 C T 7: 45,322,048 R188Q probably damaging Het
Ttbk2 A T 2: 120,748,960 H491Q probably benign Het
Urgcp C T 11: 5,716,989 E450K probably benign Het
Vmn1r228 T C 17: 20,776,375 N294D probably benign Het
Wdfy3 A T 5: 101,868,092 C2606S probably damaging Het
Wdr33 T A 18: 31,888,324 H642Q unknown Het
Zbtb46 A G 2: 181,411,774 S382P possibly damaging Het
Zfp217 A G 2: 170,119,780 I209T probably benign Het
Zranb3 T A 1: 127,963,773 N822I probably benign Het
Other mutations in Atp2b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Atp2b4 APN 1 133731889 missense probably damaging 1.00
IGL02887:Atp2b4 APN 1 133728774 missense probably damaging 1.00
IGL02964:Atp2b4 APN 1 133730565 missense probably damaging 1.00
IGL03116:Atp2b4 APN 1 133728768 missense possibly damaging 0.95
IGL03227:Atp2b4 APN 1 133729707 splice site probably benign
R0018:Atp2b4 UTSW 1 133717871 missense probably damaging 1.00
R0018:Atp2b4 UTSW 1 133717871 missense probably damaging 1.00
R0455:Atp2b4 UTSW 1 133728716 missense probably damaging 1.00
R0511:Atp2b4 UTSW 1 133732218 splice site probably benign
R0712:Atp2b4 UTSW 1 133730478 missense probably damaging 1.00
R1469:Atp2b4 UTSW 1 133706939 missense probably damaging 0.97
R1469:Atp2b4 UTSW 1 133706939 missense probably damaging 0.97
R1529:Atp2b4 UTSW 1 133717988 missense probably damaging 1.00
R1771:Atp2b4 UTSW 1 133732393 missense probably damaging 0.96
R1954:Atp2b4 UTSW 1 133739992 missense probably damaging 1.00
R2054:Atp2b4 UTSW 1 133715169 missense probably benign 0.03
R2056:Atp2b4 UTSW 1 133726537 missense probably benign 0.36
R2059:Atp2b4 UTSW 1 133726537 missense probably benign 0.36
R2091:Atp2b4 UTSW 1 133715230 missense probably benign 0.00
R2263:Atp2b4 UTSW 1 133726533 missense probably benign 0.35
R3907:Atp2b4 UTSW 1 133738586 missense probably damaging 1.00
R4362:Atp2b4 UTSW 1 133739931 missense possibly damaging 0.94
R4756:Atp2b4 UTSW 1 133711791 missense probably benign 0.00
R4756:Atp2b4 UTSW 1 133739396 missense probably benign 0.41
R4856:Atp2b4 UTSW 1 133706780 missense probably benign 0.00
R4886:Atp2b4 UTSW 1 133706780 missense probably benign 0.00
R5177:Atp2b4 UTSW 1 133728768 missense probably benign 0.00
R5454:Atp2b4 UTSW 1 133729872 missense probably damaging 1.00
R5594:Atp2b4 UTSW 1 133730510 missense probably damaging 1.00
R5712:Atp2b4 UTSW 1 133730540 missense probably damaging 1.00
R6034:Atp2b4 UTSW 1 133731907 critical splice acceptor site probably null
R6034:Atp2b4 UTSW 1 133731907 critical splice acceptor site probably null
R6078:Atp2b4 UTSW 1 133701702 small insertion probably benign
R6079:Atp2b4 UTSW 1 133701702 small insertion probably benign
R6244:Atp2b4 UTSW 1 133726561 missense probably damaging 1.00
R6376:Atp2b4 UTSW 1 133715059 missense probably damaging 1.00
R6483:Atp2b4 UTSW 1 133729880 missense possibly damaging 0.68
R6526:Atp2b4 UTSW 1 133711729 missense probably damaging 0.99
R6725:Atp2b4 UTSW 1 133706987 missense probably benign 0.01
R6801:Atp2b4 UTSW 1 133727786 missense probably damaging 0.97
R7548:Atp2b4 UTSW 1 133701641 makesense probably null
Predicted Primers PCR Primer
(F):5'- GCCTGCCCCTTGGATACCATAAAC -3'
(R):5'- TGGTACGCAATGTCATTGAGCCC -3'

Sequencing Primer
(F):5'- CTCTGTAAGTGACAAGTAGTTAGGC -3'
(R):5'- GTGAAATCCTCACTTCGCTG -3'
Posted On2013-04-16