Incidental Mutation 'R0279:Lamc2'
ID24513
Institutional Source Beutler Lab
Gene Symbol Lamc2
Ensembl Gene ENSMUSG00000026479
Gene Namelaminin, gamma 2
Synonymsnicein, 100kDa
MMRRC Submission 038501-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R0279 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location153122756-153186447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153130696 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 903 (E903G)
Ref Sequence ENSEMBL: ENSMUSP00000140514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356] [ENSMUST00000188206]
Predicted Effect probably benign
Transcript: ENSMUST00000027753
AA Change: E903G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: E903G

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185356
AA Change: E903G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: E903G

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189005
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610528J11Rik A T 4: 118,529,293 M1L probably benign Het
5730596B20Rik T A 6: 52,179,202 probably benign Het
Acrbp T C 6: 125,053,954 probably null Het
Acss3 A G 10: 107,084,871 I126T possibly damaging Het
Aff3 T C 1: 38,535,569 E110G probably damaging Het
Aldh1a3 T C 7: 66,409,252 I113V probably benign Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Atp2b4 A G 1: 133,729,702 probably benign Het
Atp8a1 C T 5: 67,813,092 probably null Het
Bhmt A G 13: 93,625,464 C104R probably damaging Het
Ccdc151 A G 9: 21,990,247 probably benign Het
Cct5 T G 15: 31,591,031 E508A probably damaging Het
Celsr1 T A 15: 85,902,864 E2761D probably benign Het
Clstn1 T C 4: 149,643,674 S600P probably damaging Het
Cnppd1 A G 1: 75,136,929 S232P probably damaging Het
Crybb3 T C 5: 113,079,753 probably null Het
Csmd1 A G 8: 16,223,235 I861T probably damaging Het
Cyp2d10 A C 15: 82,405,339 S191A possibly damaging Het
Ddx10 T C 9: 53,235,304 D206G probably damaging Het
Dnah1 G T 14: 31,302,375 H916N possibly damaging Het
Dnah9 A G 11: 65,911,789 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Etnppl A G 3: 130,629,413 R248G probably damaging Het
Eya3 T C 4: 132,719,247 F369L probably damaging Het
Fam129a T C 1: 151,709,206 probably null Het
Fam170b T C 14: 32,834,068 probably benign Het
Fli1 A T 9: 32,461,427 V105D probably damaging Het
Fmo1 T C 1: 162,830,272 I433M possibly damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Foxe3 T C 4: 114,925,568 D149G probably damaging Het
Gk5 T C 9: 96,174,804 probably benign Het
Gm14226 A G 2: 155,025,452 D443G possibly damaging Het
Gm9796 C T 11: 95,697,995 noncoding transcript Het
Golga4 A T 9: 118,568,993 R52S probably benign Het
Hey2 C A 10: 30,834,010 C249F probably damaging Het
Ipo9 A T 1: 135,420,363 probably benign Het
Ireb2 C A 9: 54,886,593 T269K probably benign Het
Kansl3 A G 1: 36,351,969 V274A probably damaging Het
Kcnk2 C T 1: 189,209,972 A352T possibly damaging Het
Lepr A G 4: 101,750,344 K253R probably benign Het
Lmntd2 T C 7: 141,213,623 probably benign Het
Lrrc39 A T 3: 116,578,303 T240S probably benign Het
Lrrc43 A G 5: 123,497,022 probably null Het
Maf T C 8: 115,705,756 M370V possibly damaging Het
Mib2 G A 4: 155,661,216 S46L possibly damaging Het
Mms22l C T 4: 24,497,867 T63I probably damaging Het
Morc2a T A 11: 3,683,989 S700R probably benign Het
Mpz A G 1: 171,159,929 probably benign Het
Ncam2 T C 16: 81,623,337 probably benign Het
Nudt14 C T 12: 112,938,417 A123T probably damaging Het
Olfr1016 A T 2: 85,799,535 I245N possibly damaging Het
Olfr13 G A 6: 43,174,758 M257I probably benign Het
Olfr239 C T 17: 33,199,324 T92I probably benign Het
Otoa T C 7: 121,111,079 probably benign Het
Pik3cg G A 12: 32,204,791 T399I probably damaging Het
Pkn3 C T 2: 30,083,297 A377V probably benign Het
Ppan A G 9: 20,891,529 N327S probably benign Het
Prkca T C 11: 108,054,111 probably benign Het
Prrc2c A T 1: 162,715,464 V320E probably damaging Het
Ptprq A G 10: 107,608,417 V1442A probably damaging Het
Rapgef1 C T 2: 29,726,227 R834C probably damaging Het
Rbms1 G T 2: 60,842,410 N44K probably damaging Het
Rfwd3 A C 8: 111,282,733 F404V probably benign Het
Rimbp3 G T 16: 17,209,453 R247L probably benign Het
Serpinb1b T C 13: 33,093,713 S310P possibly damaging Het
Smtn C A 11: 3,530,235 V329L probably damaging Het
Snapc2 T C 8: 4,254,979 probably benign Het
Spam1 A T 6: 24,800,419 M386L probably benign Het
Syne2 A G 12: 76,095,613 E6208G probably damaging Het
Teddm1a T C 1: 153,892,623 Y278H probably damaging Het
Tnfaip6 A T 2: 52,055,916 N258I possibly damaging Het
Trpm4 C T 7: 45,322,048 R188Q probably damaging Het
Ttbk2 A T 2: 120,748,960 H491Q probably benign Het
Urgcp C T 11: 5,716,989 E450K probably benign Het
Vmn1r228 T C 17: 20,776,375 N294D probably benign Het
Wdfy3 A T 5: 101,868,092 C2606S probably damaging Het
Wdr33 T A 18: 31,888,324 H642Q unknown Het
Zbtb46 A G 2: 181,411,774 S382P possibly damaging Het
Zfp217 A G 2: 170,119,780 I209T probably benign Het
Zranb3 T A 1: 127,963,773 N822I probably benign Het
Other mutations in Lamc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Lamc2 APN 1 153130056 missense probably benign 0.00
IGL00907:Lamc2 APN 1 153144651 missense probably benign 0.32
IGL02026:Lamc2 APN 1 153144736 splice site probably benign
IGL02335:Lamc2 APN 1 153166216 missense probably benign 0.00
IGL02568:Lamc2 APN 1 153166262 missense possibly damaging 0.91
IGL02640:Lamc2 APN 1 153152057 missense probably damaging 0.99
IGL02801:Lamc2 APN 1 153136783 missense probably benign 0.10
IGL02827:Lamc2 APN 1 153139781 missense probably damaging 1.00
IGL03240:Lamc2 APN 1 153124125 missense probably damaging 1.00
IGL03245:Lamc2 APN 1 153133757 splice site probably null
ANU74:Lamc2 UTSW 1 153131835 missense probably benign 0.00
R0528:Lamc2 UTSW 1 153124094 missense probably damaging 1.00
R0597:Lamc2 UTSW 1 153133621 missense probably benign 0.02
R0650:Lamc2 UTSW 1 153143876 missense possibly damaging 0.88
R0826:Lamc2 UTSW 1 153152082 missense probably damaging 1.00
R1015:Lamc2 UTSW 1 153166199 missense possibly damaging 0.53
R1172:Lamc2 UTSW 1 153166287 missense probably damaging 1.00
R1308:Lamc2 UTSW 1 153150818 missense probably damaging 1.00
R1521:Lamc2 UTSW 1 153166263 missense probably benign 0.11
R1525:Lamc2 UTSW 1 153130756 missense probably benign 0.00
R1602:Lamc2 UTSW 1 153127028 missense probably benign 0.00
R1631:Lamc2 UTSW 1 153158934 missense possibly damaging 0.95
R1633:Lamc2 UTSW 1 153141698 nonsense probably null
R1832:Lamc2 UTSW 1 153166187 missense possibly damaging 0.72
R1978:Lamc2 UTSW 1 153133597 critical splice donor site probably null
R1996:Lamc2 UTSW 1 153154470 missense possibly damaging 0.84
R2046:Lamc2 UTSW 1 153141765 missense probably benign 0.01
R2107:Lamc2 UTSW 1 153154386 splice site probably benign
R2130:Lamc2 UTSW 1 153127124 missense probably damaging 1.00
R2182:Lamc2 UTSW 1 153126866 missense possibly damaging 0.46
R2207:Lamc2 UTSW 1 153133706 missense possibly damaging 0.68
R2218:Lamc2 UTSW 1 153130779 missense probably benign 0.21
R3772:Lamc2 UTSW 1 153124251 missense probably benign
R4616:Lamc2 UTSW 1 153166169 missense probably damaging 1.00
R4874:Lamc2 UTSW 1 153154395 missense probably null 1.00
R4939:Lamc2 UTSW 1 153126836 missense probably damaging 1.00
R4985:Lamc2 UTSW 1 153136805 missense probably benign
R5544:Lamc2 UTSW 1 153124053 missense possibly damaging 0.93
R5632:Lamc2 UTSW 1 153131890 missense probably damaging 1.00
R5771:Lamc2 UTSW 1 153141594 missense probably benign 0.04
R5811:Lamc2 UTSW 1 153166253 missense possibly damaging 0.53
R6058:Lamc2 UTSW 1 153136829 missense probably benign 0.01
R6130:Lamc2 UTSW 1 153136777 missense probably benign 0.01
R6137:Lamc2 UTSW 1 153166153 missense possibly damaging 0.90
R6994:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6995:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6997:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R7000:Lamc2 UTSW 1 153166127 missense possibly damaging 0.72
R7018:Lamc2 UTSW 1 153136742 missense probably benign 0.00
R7145:Lamc2 UTSW 1 153130772 missense possibly damaging 0.95
R7148:Lamc2 UTSW 1 153185984 missense probably benign 0.01
R7171:Lamc2 UTSW 1 153139749 missense probably damaging 1.00
R7640:Lamc2 UTSW 1 153136804 missense possibly damaging 0.79
R7673:Lamc2 UTSW 1 153124036 missense probably damaging 1.00
R7684:Lamc2 UTSW 1 153127025 missense probably null 0.86
R7712:Lamc2 UTSW 1 153133611 missense possibly damaging 0.81
RF024:Lamc2 UTSW 1 153152055 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACTCCCTCTGTAACCAGTGGCATC -3'
(R):5'- ACGTTAGGGCCAGTGTCTGCTTTC -3'

Sequencing Primer
(F):5'- TCTGTAACCAGTGGCATCATGAC -3'
(R):5'- TTCAAATGGTGACAGTAGGTCC -3'
Posted On2013-04-16