Incidental Mutation 'R2295:Sult2a1'
ID245138
Institutional Source Beutler Lab
Gene Symbol Sult2a1
Ensembl Gene ENSMUSG00000078798
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
SynonymsStd, Sth1, mSTa1
MMRRC Submission 040294-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2295 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13796246-13837409 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 13835959 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108522]
Predicted Effect probably null
Transcript: ENSMUST00000108522
SMART Domains Protein: ENSMUSP00000104162
Gene: ENSMUSG00000078798

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 278 4.6e-83 PFAM
Pfam:Sulfotransfer_3 35 205 5.8e-11 PFAM
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,148,903 Y428C probably damaging Het
Adgrd1 G A 5: 129,122,506 V136I probably benign Het
Aldh5a1 A G 13: 24,926,099 F151S probably damaging Het
Alox12 T C 11: 70,242,465 I638V probably benign Het
Arhgap42 A T 9: 9,115,744 D110E probably damaging Het
Capn15 G A 17: 25,964,581 R309* probably null Het
Crmp1 A G 5: 37,265,262 I138V probably benign Het
Dennd3 G A 15: 73,523,555 probably null Het
Dsp T C 13: 38,197,046 V1990A probably benign Het
Dtna T G 18: 23,631,412 L546R probably damaging Het
Elac1 T C 18: 73,739,229 I232V probably benign Het
Hdgfl1 C T 13: 26,769,362 E243K possibly damaging Het
Hexb A G 13: 97,185,612 S222P probably damaging Het
Hs6st3 A G 14: 119,138,445 T11A probably benign Het
Il18 A G 9: 50,579,335 E90G probably benign Het
Itga8 T C 2: 12,182,709 T720A probably benign Het
Kcnt1 G T 2: 25,900,921 A11S probably damaging Het
Luzp2 T C 7: 55,172,190 probably benign Het
Mpped2 A G 2: 106,699,501 N32D possibly damaging Het
Nfic T C 10: 81,420,531 K122E probably damaging Het
Ntm A G 9: 29,109,521 V134A possibly damaging Het
Olfml2b G A 1: 170,662,538 probably benign Het
Olfr1497 A T 19: 13,794,744 I289N probably damaging Het
Olfr684 A G 7: 105,157,325 V119A probably benign Het
Osbpl9 A G 4: 109,202,134 Y28H probably damaging Het
Pikfyve T A 1: 65,246,676 Y1025N probably damaging Het
Pip5k1c G A 10: 81,305,186 A43T probably benign Het
Polb A G 8: 22,653,319 L19P probably damaging Het
Ppp1r14c T C 10: 3,366,734 F23S possibly damaging Het
Prkab1 A T 5: 116,021,656 probably null Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Slco6c1 A G 1: 97,125,748 S143P probably damaging Het
Spen T C 4: 141,477,273 N1348D unknown Het
Srgap1 T C 10: 121,794,760 K751R probably benign Het
Svopl C A 6: 38,019,733 A270S possibly damaging Het
Tekt2 T C 4: 126,323,693 probably null Het
Toporsl A G 4: 52,610,176 D23G probably damaging Het
Trim30d A C 7: 104,487,942 C18W probably damaging Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Other mutations in Sult2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Sult2a1 APN 7 13832640 missense probably benign 0.02
IGL00990:Sult2a1 APN 7 13804036 missense probably benign
IGL01322:Sult2a1 APN 7 13832679 nonsense probably null
IGL02558:Sult2a1 APN 7 13832595 missense probably benign 0.03
IGL03033:Sult2a1 APN 7 13832710 splice site probably benign
IGL03199:Sult2a1 APN 7 13832660 missense probably damaging 1.00
R1633:Sult2a1 UTSW 7 13801426 missense probably benign 0.01
R1903:Sult2a1 UTSW 7 13835975 missense possibly damaging 0.94
R4207:Sult2a1 UTSW 7 13801547 missense probably benign 0.00
R5444:Sult2a1 UTSW 7 13836019 missense possibly damaging 0.80
R6233:Sult2a1 UTSW 7 13832675 missense probably damaging 1.00
R6317:Sult2a1 UTSW 7 13836020 missense probably benign 0.00
R6853:Sult2a1 UTSW 7 13801487 missense possibly damaging 0.50
R7098:Sult2a1 UTSW 7 13816053 intron probably null
Z1088:Sult2a1 UTSW 7 13801414 missense probably benign
Z1088:Sult2a1 UTSW 7 13801435 missense probably benign 0.00
Z1088:Sult2a1 UTSW 7 13804036 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTGTGCTGGTCCACAAC -3'
(R):5'- CTTTTCATTCAGGAACGAACTGGC -3'

Sequencing Primer
(F):5'- ACAACCTTGCACTCTATCTCATATAG -3'
(R):5'- CTTGATTCAGACCAAGGGAGATCC -3'
Posted On2014-10-30