Incidental Mutation 'R2295:Pip5k1c'
ID245149
Institutional Source Beutler Lab
Gene Symbol Pip5k1c
Ensembl Gene ENSMUSG00000034902
Gene Namephosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
SynonymsPIP5KIgamma
MMRRC Submission 040294-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2295 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81292963-81319973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81305186 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 43 (A43T)
Ref Sequence ENSEMBL: ENSMUSP00000124004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000160291] [ENSMUST00000161854] [ENSMUST00000163075]
Predicted Effect probably benign
Transcript: ENSMUST00000045469
AA Change: A43T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: A43T

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105327
AA Change: A43T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902
AA Change: A43T

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000160291
SMART Domains Protein: ENSMUSP00000125645
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161854
AA Change: A43T

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902
AA Change: A43T

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163009
Predicted Effect probably benign
Transcript: ENSMUST00000163075
AA Change: A43T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902
AA Change: A43T

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,148,903 Y428C probably damaging Het
Adgrd1 G A 5: 129,122,506 V136I probably benign Het
Aldh5a1 A G 13: 24,926,099 F151S probably damaging Het
Alox12 T C 11: 70,242,465 I638V probably benign Het
Arhgap42 A T 9: 9,115,744 D110E probably damaging Het
Capn15 G A 17: 25,964,581 R309* probably null Het
Crmp1 A G 5: 37,265,262 I138V probably benign Het
Dennd3 G A 15: 73,523,555 probably null Het
Dsp T C 13: 38,197,046 V1990A probably benign Het
Dtna T G 18: 23,631,412 L546R probably damaging Het
Elac1 T C 18: 73,739,229 I232V probably benign Het
Hdgfl1 C T 13: 26,769,362 E243K possibly damaging Het
Hexb A G 13: 97,185,612 S222P probably damaging Het
Hs6st3 A G 14: 119,138,445 T11A probably benign Het
Il18 A G 9: 50,579,335 E90G probably benign Het
Itga8 T C 2: 12,182,709 T720A probably benign Het
Kcnt1 G T 2: 25,900,921 A11S probably damaging Het
Luzp2 T C 7: 55,172,190 probably benign Het
Mpped2 A G 2: 106,699,501 N32D possibly damaging Het
Nfic T C 10: 81,420,531 K122E probably damaging Het
Ntm A G 9: 29,109,521 V134A possibly damaging Het
Olfml2b G A 1: 170,662,538 probably benign Het
Olfr1497 A T 19: 13,794,744 I289N probably damaging Het
Olfr684 A G 7: 105,157,325 V119A probably benign Het
Osbpl9 A G 4: 109,202,134 Y28H probably damaging Het
Pikfyve T A 1: 65,246,676 Y1025N probably damaging Het
Polb A G 8: 22,653,319 L19P probably damaging Het
Ppp1r14c T C 10: 3,366,734 F23S possibly damaging Het
Prkab1 A T 5: 116,021,656 probably null Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Slco6c1 A G 1: 97,125,748 S143P probably damaging Het
Spen T C 4: 141,477,273 N1348D unknown Het
Srgap1 T C 10: 121,794,760 K751R probably benign Het
Sult2a1 A G 7: 13,835,959 probably null Het
Svopl C A 6: 38,019,733 A270S possibly damaging Het
Tekt2 T C 4: 126,323,693 probably null Het
Toporsl A G 4: 52,610,176 D23G probably damaging Het
Trim30d A C 7: 104,487,942 C18W probably damaging Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Other mutations in Pip5k1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pip5k1c APN 10 81305711 missense probably benign 0.45
IGL02274:Pip5k1c APN 10 81306384 missense probably damaging 1.00
IGL02500:Pip5k1c APN 10 81317321 splice site probably null
IGL02565:Pip5k1c APN 10 81317321 splice site probably null
IGL02577:Pip5k1c APN 10 81317321 splice site probably null
IGL02579:Pip5k1c APN 10 81317321 splice site probably null
IGL02581:Pip5k1c APN 10 81317321 splice site probably null
IGL02604:Pip5k1c APN 10 81317321 splice site probably null
IGL02610:Pip5k1c APN 10 81317321 splice site probably null
IGL02613:Pip5k1c APN 10 81317321 splice site probably null
IGL02616:Pip5k1c APN 10 81317321 splice site probably null
IGL02617:Pip5k1c APN 10 81317321 splice site probably null
IGL02639:Pip5k1c APN 10 81317321 splice site probably null
IGL02641:Pip5k1c APN 10 81317321 splice site probably null
IGL02642:Pip5k1c APN 10 81317321 splice site probably null
IGL02724:Pip5k1c APN 10 81313462 missense probably benign 0.01
IGL02751:Pip5k1c APN 10 81317321 splice site probably null
PIT4366001:Pip5k1c UTSW 10 81309008 missense probably damaging 0.98
R0257:Pip5k1c UTSW 10 81315096 missense possibly damaging 0.86
R1643:Pip5k1c UTSW 10 81314994 missense probably damaging 1.00
R1663:Pip5k1c UTSW 10 81312515 missense probably damaging 1.00
R1872:Pip5k1c UTSW 10 81306319 missense probably damaging 0.99
R2293:Pip5k1c UTSW 10 81314084 missense possibly damaging 0.82
R2310:Pip5k1c UTSW 10 81306308 missense probably damaging 0.96
R2406:Pip5k1c UTSW 10 81309024 missense probably damaging 1.00
R4504:Pip5k1c UTSW 10 81315111 missense probably damaging 0.98
R4772:Pip5k1c UTSW 10 81315940 missense probably benign
R5022:Pip5k1c UTSW 10 81310889 splice site probably null
R5023:Pip5k1c UTSW 10 81310889 splice site probably null
R5033:Pip5k1c UTSW 10 81305250 missense probably damaging 0.99
R5057:Pip5k1c UTSW 10 81310889 splice site probably null
R5482:Pip5k1c UTSW 10 81293063 missense probably damaging 0.98
R6305:Pip5k1c UTSW 10 81315934 missense probably benign 0.02
R6511:Pip5k1c UTSW 10 81310817 missense probably damaging 1.00
R6544:Pip5k1c UTSW 10 81308996 missense probably damaging 1.00
R7512:Pip5k1c UTSW 10 81315119 critical splice donor site probably null
R7581:Pip5k1c UTSW 10 81308960 missense probably damaging 1.00
Z1177:Pip5k1c UTSW 10 81315032 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATCTGGGTTCCTGGAAGCAG -3'
(R):5'- TCATGACGGCTGACACTTTAG -3'

Sequencing Primer
(F):5'- TTCCTGGAAGCAGCGTGC -3'
(R):5'- TGACGGCTGACACTTTAGCAGAC -3'
Posted On2014-10-30