Incidental Mutation 'R2295:Dtna'
ID245161
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Namedystrobrevin alpha
Synonymsalpha-dystrobrevin, adbn, Dtn, a-DB-1, A0, 87K protein, 2210407P21Rik
MMRRC Submission 040294-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R2295 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location23415135-23659715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23631412 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 546 (L546R)
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000221880]
Predicted Effect probably damaging
Transcript: ENSMUST00000115832
AA Change: L489R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: L489R

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220904
AA Change: L546R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221880
AA Change: L546R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,148,903 Y428C probably damaging Het
Adgrd1 G A 5: 129,122,506 V136I probably benign Het
Aldh5a1 A G 13: 24,926,099 F151S probably damaging Het
Alox12 T C 11: 70,242,465 I638V probably benign Het
Arhgap42 A T 9: 9,115,744 D110E probably damaging Het
Capn15 G A 17: 25,964,581 R309* probably null Het
Crmp1 A G 5: 37,265,262 I138V probably benign Het
Dennd3 G A 15: 73,523,555 probably null Het
Dsp T C 13: 38,197,046 V1990A probably benign Het
Elac1 T C 18: 73,739,229 I232V probably benign Het
Hdgfl1 C T 13: 26,769,362 E243K possibly damaging Het
Hexb A G 13: 97,185,612 S222P probably damaging Het
Hs6st3 A G 14: 119,138,445 T11A probably benign Het
Il18 A G 9: 50,579,335 E90G probably benign Het
Itga8 T C 2: 12,182,709 T720A probably benign Het
Kcnt1 G T 2: 25,900,921 A11S probably damaging Het
Luzp2 T C 7: 55,172,190 probably benign Het
Mpped2 A G 2: 106,699,501 N32D possibly damaging Het
Nfic T C 10: 81,420,531 K122E probably damaging Het
Ntm A G 9: 29,109,521 V134A possibly damaging Het
Olfml2b G A 1: 170,662,538 probably benign Het
Olfr1497 A T 19: 13,794,744 I289N probably damaging Het
Olfr684 A G 7: 105,157,325 V119A probably benign Het
Osbpl9 A G 4: 109,202,134 Y28H probably damaging Het
Pikfyve T A 1: 65,246,676 Y1025N probably damaging Het
Pip5k1c G A 10: 81,305,186 A43T probably benign Het
Polb A G 8: 22,653,319 L19P probably damaging Het
Ppp1r14c T C 10: 3,366,734 F23S possibly damaging Het
Prkab1 A T 5: 116,021,656 probably null Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Slco6c1 A G 1: 97,125,748 S143P probably damaging Het
Spen T C 4: 141,477,273 N1348D unknown Het
Srgap1 T C 10: 121,794,760 K751R probably benign Het
Sult2a1 A G 7: 13,835,959 probably null Het
Svopl C A 6: 38,019,733 A270S possibly damaging Het
Tekt2 T C 4: 126,323,693 probably null Het
Toporsl A G 4: 52,610,176 D23G probably damaging Het
Trim30d A C 7: 104,487,942 C18W probably damaging Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23597488 missense probably benign 0.22
IGL01620:Dtna APN 18 23625087 missense probably damaging 1.00
IGL01705:Dtna APN 18 23545731 missense probably damaging 1.00
IGL01914:Dtna APN 18 23597459 missense possibly damaging 0.62
IGL02388:Dtna APN 18 23597514 missense probably benign 0.00
IGL02427:Dtna APN 18 23651538 missense possibly damaging 0.95
IGL03074:Dtna APN 18 23602605 missense possibly damaging 0.74
R0041:Dtna UTSW 18 23646875 unclassified probably benign
R0041:Dtna UTSW 18 23646875 unclassified probably benign
R0078:Dtna UTSW 18 23621442 missense probably damaging 1.00
R0390:Dtna UTSW 18 23597501 missense probably damaging 1.00
R1808:Dtna UTSW 18 23569640 missense probably damaging 1.00
R1872:Dtna UTSW 18 23597560 critical splice donor site probably null
R2095:Dtna UTSW 18 23569748 missense probably damaging 1.00
R2216:Dtna UTSW 18 23569565 missense probably damaging 1.00
R2402:Dtna UTSW 18 23595478 nonsense probably null
R2846:Dtna UTSW 18 23651503 splice site probably null
R3836:Dtna UTSW 18 23625102 missense probably damaging 1.00
R4764:Dtna UTSW 18 23535149 splice site probably null
R4893:Dtna UTSW 18 23569667 missense probably damaging 0.99
R5194:Dtna UTSW 18 23590245 nonsense probably null
R5373:Dtna UTSW 18 23651613 missense probably damaging 1.00
R5374:Dtna UTSW 18 23651613 missense probably damaging 1.00
R5526:Dtna UTSW 18 23646230 missense probably damaging 0.99
R5755:Dtna UTSW 18 23621463 missense probably benign
R5769:Dtna UTSW 18 23651554 missense probably benign 0.27
R6062:Dtna UTSW 18 23622056 missense possibly damaging 0.87
R6413:Dtna UTSW 18 23622014 missense probably damaging 1.00
R6876:Dtna UTSW 18 23611110 missense probably benign 0.00
R7103:Dtna UTSW 18 23653379 critical splice donor site probably null
R7711:Dtna UTSW 18 23625196 critical splice donor site probably null
R7804:Dtna UTSW 18 23595609 missense probably damaging 0.97
R8156:Dtna UTSW 18 23590331 nonsense probably null
R8437:Dtna UTSW 18 23590341 nonsense probably null
R8786:Dtna UTSW 18 23583133 missense probably benign 0.10
X0063:Dtna UTSW 18 23643168 missense probably damaging 0.98
X0066:Dtna UTSW 18 23592981 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ACCCACTTTAAGACAGTTACCTAG -3'
(R):5'- ACTGCTAGTCCTTCACAGGC -3'

Sequencing Primer
(F):5'- GAAGTCTAGACATGCCCTCTTAG -3'
(R):5'- GCTAGTCCTTCACAGGCCTAAG -3'
Posted On2014-10-30