Mutagenetix > Incidental Mutation

Incidental Mutation 'R2296:Trp53bp1'

245168

Institutional Source

Beutler Lab

Gene Symbol

Trp53bp1

Ensembl Gene

ENSMUSG00000043909

Gene Name

transformation related protein 53 binding protein 1

Synonyms

53BP1, p53BP1

MMRRC Submission

040295-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2296 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121023762-121101888 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121039728 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1304 (S1304T)

Ref Sequence

ENSEMBL: ENSMUSP00000106278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000154426]

AlphaFold

P70399

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110647
AA Change: S1304T

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: S1304T

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1430	1551	2.5e-80	PFAM
low complexity region	1581	1601	N/A	INTRINSIC
BRCT	1673	1785	7.13e-1	SMART
BRCT	1813	1901	1.03e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110648
AA Change: S1304T

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: S1304T

Domain	Start	End	E-Value	Type
low complexity region	136	149	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	647	661	N/A	INTRINSIC
low complexity region	1031	1042	N/A	INTRINSIC
low complexity region	1099	1112	N/A	INTRINSIC
low complexity region	1260	1272	N/A	INTRINSIC
low complexity region	1290	1332	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
Pfam:53-BP1_Tudor	1480	1601	1.5e-80	PFAM
low complexity region	1631	1651	N/A	INTRINSIC
BRCT	1723	1835	7.13e-1	SMART
BRCT	1863	1951	1.03e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124411

Predicted Effect

probably benign
Transcript: ENSMUST00000124554

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140582

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147554

Predicted Effect

probably benign
Transcript: ENSMUST00000147540

Predicted Effect

probably benign
Transcript: ENSMUST00000154426

SMART Domains

Protein: ENSMUSP00000117548
Gene: ENSMUSG00000043909

Domain	Start	End	E-Value	Type
Pfam:53-BP1_Tudor	1	70	2.5e-44	PFAM
low complexity region	100	120	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	G	1: 11,582,275 (GRCm39)	E68G	possibly damaging	Het
Apob	A	G	12: 8,044,879 (GRCm39)	D820G	probably damaging	Het
Bglap3	G	C	3: 88,276,819 (GRCm39)		probably benign	Het
Calr3	C	T	8: 73,178,469 (GRCm39)		probably benign	Het
Carmil1	A	G	13: 24,299,492 (GRCm39)	L344P	probably damaging	Het
Cop1	G	A	1: 159,072,220 (GRCm39)	V109M	possibly damaging	Het
Dennd4b	T	A	3: 90,182,821 (GRCm39)	N879K	probably damaging	Het
Fam13b	T	C	18: 34,627,814 (GRCm39)	D129G	possibly damaging	Het
Fam222a	C	A	5: 114,749,027 (GRCm39)	H74Q	possibly damaging	Het
Gata5	A	G	2: 179,970,113 (GRCm39)	M278T	possibly damaging	Het
Grm7	G	T	6: 110,623,309 (GRCm39)	V161F	probably damaging	Het
Iigp1c	T	A	18: 60,378,542 (GRCm39)	C26S	probably benign	Het
Inpp5k	T	G	11: 75,530,313 (GRCm39)	L251R	probably damaging	Het
Lrrc36	T	G	8: 106,187,651 (GRCm39)	D522E	possibly damaging	Het
Mrc2	G	A	11: 105,239,257 (GRCm39)		probably null	Het
Nras	T	A	3: 102,966,350 (GRCm39)		probably null	Het
Nudt12	A	G	17: 59,317,044 (GRCm39)	V201A	possibly damaging	Het
Phf2	T	C	13: 48,988,754 (GRCm39)	E39G	unknown	Het
Serpinb3a	A	T	1: 106,975,291 (GRCm39)	V172D	probably damaging	Het
Stab2	T	A	10: 86,790,338 (GRCm39)		probably null	Het
Trim3	A	G	7: 105,262,481 (GRCm39)	I559T	probably damaging	Het
Xrcc5	A	T	1: 72,385,485 (GRCm39)	K525N	probably benign	Het
Zfp110	T	A	7: 12,583,467 (GRCm39)	V705D	probably damaging	Het

Other mutations in Trp53bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Trp53bp1	APN	2	121,087,060 (GRCm39)	missense	possibly damaging	0.69
IGL00690:Trp53bp1	APN	2	121,066,476 (GRCm39)	missense	probably damaging	1.00
IGL00922:Trp53bp1	APN	2	121,038,963 (GRCm39)	missense	probably damaging	0.96
IGL01475:Trp53bp1	APN	2	121,100,800 (GRCm39)	splice site	probably null
IGL01639:Trp53bp1	APN	2	121,033,173 (GRCm39)	missense	possibly damaging	0.51
IGL01662:Trp53bp1	APN	2	121,066,506 (GRCm39)	missense	probably damaging	1.00
IGL01757:Trp53bp1	APN	2	121,041,785 (GRCm39)	missense	probably damaging	0.99
IGL01829:Trp53bp1	APN	2	121,046,377 (GRCm39)	missense	probably benign	0.39
IGL02247:Trp53bp1	APN	2	121,067,070 (GRCm39)	missense	probably damaging	1.00
IGL02349:Trp53bp1	APN	2	121,029,555 (GRCm39)	missense	probably damaging	1.00
IGL02391:Trp53bp1	APN	2	121,033,191 (GRCm39)	missense	possibly damaging	0.67
chives	UTSW	2	121,082,349 (GRCm39)	missense	probably null	0.13
concur	UTSW	2	121,100,800 (GRCm39)	splice site	probably null
confirmation	UTSW	2	121,035,594 (GRCm39)	critical splice acceptor site	probably null
Infra	UTSW	2	121,077,980 (GRCm39)	critical splice donor site	probably null
Legume	UTSW	2	121,029,523 (GRCm39)	missense	probably damaging	0.99
lentil	UTSW	2	121,082,349 (GRCm39)	missense	probably null	0.13
lentil2	UTSW	2	121,038,368 (GRCm39)	missense	probably damaging	1.00
Profundus	UTSW	2	121,038,284 (GRCm39)	missense	probably damaging	1.00
split_pea	UTSW	2	121,059,087 (GRCm39)	nonsense	probably null
verily	UTSW	2	121,041,794 (GRCm39)	missense	probably damaging	1.00
PIT1430001:Trp53bp1	UTSW	2	121,101,756 (GRCm39)	missense	probably damaging	1.00
R0045:Trp53bp1	UTSW	2	121,034,978 (GRCm39)	missense	probably benign
R0060:Trp53bp1	UTSW	2	121,035,006 (GRCm39)	missense	probably damaging	1.00
R0060:Trp53bp1	UTSW	2	121,035,006 (GRCm39)	missense	probably damaging	1.00
R0103:Trp53bp1	UTSW	2	121,067,240 (GRCm39)	missense	possibly damaging	0.92
R0103:Trp53bp1	UTSW	2	121,067,240 (GRCm39)	missense	possibly damaging	0.92
R0281:Trp53bp1	UTSW	2	121,100,718 (GRCm39)	missense	probably damaging	1.00
R0386:Trp53bp1	UTSW	2	121,035,424 (GRCm39)	missense	probably damaging	1.00
R0427:Trp53bp1	UTSW	2	121,066,498 (GRCm39)	missense	probably damaging	1.00
R0505:Trp53bp1	UTSW	2	121,100,450 (GRCm39)	missense	probably damaging	0.99
R0522:Trp53bp1	UTSW	2	121,082,349 (GRCm39)	missense	probably null	0.13
R0523:Trp53bp1	UTSW	2	121,082,349 (GRCm39)	missense	probably null	0.13
R0525:Trp53bp1	UTSW	2	121,082,349 (GRCm39)	missense	probably null	0.13
R0543:Trp53bp1	UTSW	2	121,082,349 (GRCm39)	missense	probably null	0.13
R0559:Trp53bp1	UTSW	2	121,058,282 (GRCm39)	missense	probably damaging	1.00
R0573:Trp53bp1	UTSW	2	121,058,653 (GRCm39)	splice site	probably benign
R0593:Trp53bp1	UTSW	2	121,101,009 (GRCm39)	missense	possibly damaging	0.95
R0648:Trp53bp1	UTSW	2	121,066,188 (GRCm39)	missense	probably benign	0.20
R0680:Trp53bp1	UTSW	2	121,082,349 (GRCm39)	missense	probably null	0.13
R0732:Trp53bp1	UTSW	2	121,078,745 (GRCm39)	missense	probably null	0.96
R0905:Trp53bp1	UTSW	2	121,034,799 (GRCm39)	splice site	probably benign
R1377:Trp53bp1	UTSW	2	121,101,123 (GRCm39)	missense	probably damaging	1.00
R1415:Trp53bp1	UTSW	2	121,066,665 (GRCm39)	missense	probably damaging	1.00
R1725:Trp53bp1	UTSW	2	121,082,481 (GRCm39)	missense	possibly damaging	0.46
R1971:Trp53bp1	UTSW	2	121,035,517 (GRCm39)	missense	probably damaging	1.00
R2045:Trp53bp1	UTSW	2	121,034,964 (GRCm39)	missense	probably benign
R2143:Trp53bp1	UTSW	2	121,046,545 (GRCm39)	missense	probably benign	0.00
R2282:Trp53bp1	UTSW	2	121,100,754 (GRCm39)	nonsense	probably null
R3106:Trp53bp1	UTSW	2	121,067,133 (GRCm39)	missense	probably damaging	1.00
R3792:Trp53bp1	UTSW	2	121,030,810 (GRCm39)	missense	probably damaging	1.00
R3793:Trp53bp1	UTSW	2	121,030,810 (GRCm39)	missense	probably damaging	1.00
R3946:Trp53bp1	UTSW	2	121,059,107 (GRCm39)	missense	probably damaging	0.99
R4001:Trp53bp1	UTSW	2	121,035,566 (GRCm39)	missense	probably damaging	1.00
R4327:Trp53bp1	UTSW	2	121,087,131 (GRCm39)	missense	probably damaging	1.00
R4585:Trp53bp1	UTSW	2	121,038,432 (GRCm39)	missense	probably damaging	1.00
R4630:Trp53bp1	UTSW	2	121,038,368 (GRCm39)	missense	probably damaging	1.00
R4744:Trp53bp1	UTSW	2	121,041,794 (GRCm39)	missense	probably damaging	1.00
R4751:Trp53bp1	UTSW	2	121,058,290 (GRCm39)	missense	probably damaging	1.00
R4754:Trp53bp1	UTSW	2	121,038,360 (GRCm39)	missense	probably damaging	1.00
R4755:Trp53bp1	UTSW	2	121,059,087 (GRCm39)	nonsense	probably null
R4850:Trp53bp1	UTSW	2	121,035,594 (GRCm39)	critical splice acceptor site	probably null
R4870:Trp53bp1	UTSW	2	121,087,122 (GRCm39)	missense	probably damaging	1.00
R4879:Trp53bp1	UTSW	2	121,033,084 (GRCm39)	missense	probably damaging	0.99
R4924:Trp53bp1	UTSW	2	121,051,701 (GRCm39)	nonsense	probably null
R4962:Trp53bp1	UTSW	2	121,101,027 (GRCm39)	missense	probably benign	0.12
R5019:Trp53bp1	UTSW	2	121,100,800 (GRCm39)	splice site	probably null
R5111:Trp53bp1	UTSW	2	121,041,868 (GRCm39)	missense	probably damaging	0.99
R5149:Trp53bp1	UTSW	2	121,046,598 (GRCm39)	missense	probably benign	0.00
R5252:Trp53bp1	UTSW	2	121,074,464 (GRCm39)	missense	probably benign	0.40
R5533:Trp53bp1	UTSW	2	121,038,227 (GRCm39)	missense	probably damaging	1.00
R5642:Trp53bp1	UTSW	2	121,067,143 (GRCm39)	missense	probably benign	0.00
R5773:Trp53bp1	UTSW	2	121,074,395 (GRCm39)	missense	probably damaging	1.00
R5819:Trp53bp1	UTSW	2	121,038,873 (GRCm39)	nonsense	probably null
R5886:Trp53bp1	UTSW	2	121,035,502 (GRCm39)	missense	probably damaging	1.00
R5908:Trp53bp1	UTSW	2	121,067,304 (GRCm39)	missense	probably benign	0.06
R6012:Trp53bp1	UTSW	2	121,087,083 (GRCm39)	missense	probably benign	0.07
R6351:Trp53bp1	UTSW	2	121,100,426 (GRCm39)	missense	probably damaging	1.00
R6406:Trp53bp1	UTSW	2	121,101,093 (GRCm39)	missense	probably damaging	0.99
R6575:Trp53bp1	UTSW	2	121,059,084 (GRCm39)	missense	probably damaging	1.00
R6619:Trp53bp1	UTSW	2	121,077,980 (GRCm39)	critical splice donor site	probably null
R6626:Trp53bp1	UTSW	2	121,038,284 (GRCm39)	missense	probably damaging	1.00
R6754:Trp53bp1	UTSW	2	121,101,057 (GRCm39)	missense	possibly damaging	0.83
R6765:Trp53bp1	UTSW	2	121,039,790 (GRCm39)	missense	probably damaging	1.00
R6806:Trp53bp1	UTSW	2	121,059,147 (GRCm39)	missense	probably damaging	0.99
R6860:Trp53bp1	UTSW	2	121,029,594 (GRCm39)	missense	probably damaging	1.00
R6991:Trp53bp1	UTSW	2	121,038,521 (GRCm39)	missense	probably damaging	1.00
R7278:Trp53bp1	UTSW	2	121,029,516 (GRCm39)	missense	probably damaging	1.00
R7339:Trp53bp1	UTSW	2	121,066,950 (GRCm39)	missense	probably benign	0.00
R7357:Trp53bp1	UTSW	2	121,041,781 (GRCm39)	missense	probably damaging	1.00
R7477:Trp53bp1	UTSW	2	121,066,827 (GRCm39)	missense	probably benign	0.34
R7577:Trp53bp1	UTSW	2	121,067,119 (GRCm39)	missense	possibly damaging	0.65
R7643:Trp53bp1	UTSW	2	121,078,295 (GRCm39)	splice site	probably null
R7728:Trp53bp1	UTSW	2	121,038,380 (GRCm39)	missense	probably damaging	1.00
R7806:Trp53bp1	UTSW	2	121,035,542 (GRCm39)	missense	probably damaging	0.99
R7955:Trp53bp1	UTSW	2	121,066,225 (GRCm39)	missense	possibly damaging	0.59
R8099:Trp53bp1	UTSW	2	121,030,230 (GRCm39)	missense	probably damaging	1.00
R8200:Trp53bp1	UTSW	2	121,066,657 (GRCm39)	missense	probably benign	0.00
R8282:Trp53bp1	UTSW	2	121,029,523 (GRCm39)	missense	probably damaging	0.99
R9136:Trp53bp1	UTSW	2	121,067,092 (GRCm39)	missense	possibly damaging	0.84
R9152:Trp53bp1	UTSW	2	121,029,056 (GRCm39)	missense	probably damaging	0.99
R9292:Trp53bp1	UTSW	2	121,046,177 (GRCm39)	missense	probably damaging	0.97
R9340:Trp53bp1	UTSW	2	121,100,460 (GRCm39)	missense	probably benign	0.40
R9475:Trp53bp1	UTSW	2	121,039,761 (GRCm39)	missense	probably benign	0.00
R9616:Trp53bp1	UTSW	2	121,066,657 (GRCm39)	missense	probably benign	0.30
R9675:Trp53bp1	UTSW	2	121,087,089 (GRCm39)	missense	probably benign	0.03
R9779:Trp53bp1	UTSW	2	121,066,469 (GRCm39)	missense	probably damaging	1.00
RF046:Trp53bp1	UTSW	2	121,046,482 (GRCm39)	frame shift	probably null
Z1088:Trp53bp1	UTSW	2	121,084,126 (GRCm39)	missense	probably benign	0.04
Z1177:Trp53bp1	UTSW	2	121,074,541 (GRCm39)	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- AGAACCTGTCTGCACCTCAG -3'
(R):5'- ATTCCCACCTGGCTGATAGGAC -3'

Sequencing Primer
(F):5'- GAACCTGTCTGCACCTCAGTTTTC -3'
(R):5'- ACCTGGCTGATAGGACATTTC -3'

Posted On

2014-10-30