Incidental Mutation 'R2296:Zfp110'
ID245175
Institutional Source Beutler Lab
Gene Symbol Zfp110
Ensembl Gene ENSMUSG00000058638
Gene Namezinc finger protein 110
SynonymsNrif1, NRIF, 2900024E01Rik
MMRRC Submission 040295-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R2296 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12834761-12850577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12849540 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 705 (V705D)
Ref Sequence ENSEMBL: ENSMUSP00000132060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004614] [ENSMUST00000168247]
Predicted Effect probably damaging
Transcript: ENSMUST00000004614
AA Change: V705D

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004614
Gene: ENSMUSG00000058638
AA Change: V705D

DomainStartEndE-ValueType
KRAB 18 78 1.38e-26 SMART
SCAN 158 269 1.48e-39 SMART
KRAB 284 351 2.94e-12 SMART
low complexity region 424 438 N/A INTRINSIC
ZnF_C2H2 688 710 1.43e-1 SMART
ZnF_C2H2 716 738 2.24e-3 SMART
ZnF_C2H2 744 766 2.27e-4 SMART
ZnF_C2H2 772 794 6.32e-3 SMART
ZnF_C2H2 800 822 2.75e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137718
Predicted Effect probably damaging
Transcript: ENSMUST00000168247
AA Change: V705D

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132060
Gene: ENSMUSG00000058638
AA Change: V705D

DomainStartEndE-ValueType
KRAB 18 78 1.38e-26 SMART
SCAN 158 269 1.48e-39 SMART
KRAB 284 351 2.94e-12 SMART
low complexity region 424 438 N/A INTRINSIC
ZnF_C2H2 688 710 1.43e-1 SMART
ZnF_C2H2 716 738 2.24e-3 SMART
ZnF_C2H2 744 766 2.27e-4 SMART
ZnF_C2H2 772 794 6.32e-3 SMART
ZnF_C2H2 800 822 2.75e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants on a C57BL/6 background die at embryonic day 12. On a strain 129 background, mutants are viable and fertile, but males are more docile and testis weight is greatly reduced. On an F2 background, 20% of homozygous pups die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,512,051 E68G possibly damaging Het
Apob A G 12: 7,994,879 D820G probably damaging Het
Bglap3 G C 3: 88,369,512 probably benign Het
Calr3 C T 8: 72,424,625 probably benign Het
Carmil1 A G 13: 24,115,509 L344P probably damaging Het
Cop1 G A 1: 159,244,650 V109M possibly damaging Het
Dennd4b T A 3: 90,275,514 N879K probably damaging Het
Fam13b T C 18: 34,494,761 D129G possibly damaging Het
Fam222a C A 5: 114,610,966 H74Q possibly damaging Het
Gata5 A G 2: 180,328,320 M278T possibly damaging Het
Gm4951 T A 18: 60,245,470 C26S probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Inpp5k T G 11: 75,639,487 L251R probably damaging Het
Lrrc36 T G 8: 105,461,019 D522E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nras T A 3: 103,059,034 probably null Het
Nudt12 A G 17: 59,010,049 V201A possibly damaging Het
Phf2 T C 13: 48,835,278 E39G unknown Het
Serpinb3a A T 1: 107,047,561 V172D probably damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Trim3 A G 7: 105,613,274 I559T probably damaging Het
Trp53bp1 A T 2: 121,209,247 S1304T possibly damaging Het
Xrcc5 A T 1: 72,346,326 K525N probably benign Het
Other mutations in Zfp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp110 APN 7 12849159 missense probably benign 0.38
IGL01094:Zfp110 APN 7 12849796 missense probably damaging 1.00
IGL01576:Zfp110 APN 7 12849671 missense probably damaging 1.00
IGL01859:Zfp110 APN 7 12849540 missense possibly damaging 0.86
IGL02003:Zfp110 APN 7 12849905 nonsense probably null
R0122:Zfp110 UTSW 7 12848597 missense possibly damaging 0.51
R0357:Zfp110 UTSW 7 12836375 missense probably damaging 0.98
R0383:Zfp110 UTSW 7 12849260 missense probably benign 0.00
R0725:Zfp110 UTSW 7 12836363 missense possibly damaging 0.52
R0926:Zfp110 UTSW 7 12849881 nonsense probably null
R1146:Zfp110 UTSW 7 12846794 critical splice acceptor site probably null
R1146:Zfp110 UTSW 7 12846794 critical splice acceptor site probably null
R1472:Zfp110 UTSW 7 12848541 missense possibly damaging 0.85
R1663:Zfp110 UTSW 7 12848642 missense probably benign 0.08
R1975:Zfp110 UTSW 7 12848502 missense probably benign 0.00
R2046:Zfp110 UTSW 7 12849422 missense probably benign 0.00
R2341:Zfp110 UTSW 7 12849186 missense probably benign 0.04
R4332:Zfp110 UTSW 7 12844571 nonsense probably null
R5892:Zfp110 UTSW 7 12848478 missense probably benign 0.00
R5955:Zfp110 UTSW 7 12848745 missense possibly damaging 0.85
R6083:Zfp110 UTSW 7 12844675 missense possibly damaging 0.95
R6115:Zfp110 UTSW 7 12849774 missense probably damaging 0.98
R7187:Zfp110 UTSW 7 12849826 nonsense probably null
R7455:Zfp110 UTSW 7 12848057 missense probably benign
R7570:Zfp110 UTSW 7 12849340 missense possibly damaging 0.94
R7727:Zfp110 UTSW 7 12848995 missense possibly damaging 0.91
R7895:Zfp110 UTSW 7 12837093 missense possibly damaging 0.86
R7978:Zfp110 UTSW 7 12837093 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GACAGGGAAATCAATGCTTCC -3'
(R):5'- CCAGTATGAGTTCTCAGGTGC -3'

Sequencing Primer
(F):5'- CAATGCTTCCATAAAATGTGATCCC -3'
(R):5'- CTGAGAGATGGCTGAGCGGTC -3'
Posted On2014-10-30