Incidental Mutation 'R2296:Calr3'
ID245177
Institutional Source Beutler Lab
Gene Symbol Calr3
Ensembl Gene ENSMUSG00000019732
Gene Namecalreticulin 3
SynonymsCrt2, 6330586I20Rik, calsperin, 1700031L01Rik
MMRRC Submission 040295-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2296 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72424176-72443870 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 72424625 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019876] [ENSMUST00000109974] [ENSMUST00000163643] [ENSMUST00000212121] [ENSMUST00000212590]
Predicted Effect unknown
Transcript: ENSMUST00000019876
AA Change: G378D
SMART Domains Protein: ENSMUSP00000019876
Gene: ENSMUSG00000019732
AA Change: G378D

DomainStartEndE-ValueType
Pfam:Calreticulin 23 256 5.7e-40 PFAM
Pfam:Calreticulin 255 315 6.6e-7 PFAM
low complexity region 345 359 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109974
AA Change: G270D
SMART Domains Protein: ENSMUSP00000105601
Gene: ENSMUSG00000019732
AA Change: G270D

DomainStartEndE-ValueType
Pfam:Calreticulin 23 207 7.9e-32 PFAM
low complexity region 237 251 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120752
Predicted Effect probably benign
Transcript: ENSMUST00000163643
SMART Domains Protein: ENSMUSP00000129739
Gene: ENSMUSG00000006276

DomainStartEndE-ValueType
EH 8 103 1.45e-21 SMART
EFh 52 80 6.56e0 SMART
EH 120 214 6.1e-47 SMART
EFh 163 191 4.35e-2 SMART
low complexity region 241 255 N/A INTRINSIC
EH 266 362 5.08e-44 SMART
EFh 276 304 1.09e0 SMART
coiled coil region 381 564 N/A INTRINSIC
internal_repeat_2 615 656 1.56e-6 PROSPERO
low complexity region 661 678 N/A INTRINSIC
low complexity region 701 722 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
low complexity region 775 790 N/A INTRINSIC
internal_repeat_2 809 839 1.56e-6 PROSPERO
low complexity region 840 853 N/A INTRINSIC
UIM 863 882 3.98e1 SMART
UIM 889 907 3.76e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211977
Predicted Effect probably benign
Transcript: ENSMUST00000212121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212189
Predicted Effect probably benign
Transcript: ENSMUST00000212590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212950
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the calreticulin family, members of which are calcium-binding chaperones localized mainly in the endoplasmic reticulum. This protein is also localized to the endoplasmic reticulum lumen, however, its capacity for calcium-binding may be absent or much lower than other family members. This gene is specifically expressed in the testis, and may be required for sperm fertility. Mutation in this gene has been associated with familial hypertrophic cardiomyopathy. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with impaired zona pellucida binding and fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,512,051 E68G possibly damaging Het
Apob A G 12: 7,994,879 D820G probably damaging Het
Bglap3 G C 3: 88,369,512 probably benign Het
Carmil1 A G 13: 24,115,509 L344P probably damaging Het
Cop1 G A 1: 159,244,650 V109M possibly damaging Het
Dennd4b T A 3: 90,275,514 N879K probably damaging Het
Fam13b T C 18: 34,494,761 D129G possibly damaging Het
Fam222a C A 5: 114,610,966 H74Q possibly damaging Het
Gata5 A G 2: 180,328,320 M278T possibly damaging Het
Gm4951 T A 18: 60,245,470 C26S probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Inpp5k T G 11: 75,639,487 L251R probably damaging Het
Lrrc36 T G 8: 105,461,019 D522E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nras T A 3: 103,059,034 probably null Het
Nudt12 A G 17: 59,010,049 V201A possibly damaging Het
Phf2 T C 13: 48,835,278 E39G unknown Het
Serpinb3a A T 1: 107,047,561 V172D probably damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Trim3 A G 7: 105,613,274 I559T probably damaging Het
Trp53bp1 A T 2: 121,209,247 S1304T possibly damaging Het
Xrcc5 A T 1: 72,346,326 K525N probably benign Het
Zfp110 T A 7: 12,849,540 V705D probably damaging Het
Other mutations in Calr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Calr3 APN 8 72431396 nonsense probably null
IGL01358:Calr3 APN 8 72427213 nonsense probably null
IGL02440:Calr3 APN 8 72431432 missense probably benign 0.30
IGL02646:Calr3 APN 8 72443460 missense possibly damaging 0.89
IGL02882:Calr3 APN 8 72434821 missense probably damaging 0.99
IGL02945:Calr3 APN 8 72438557 missense probably damaging 1.00
IGL03025:Calr3 APN 8 72434891 splice site probably benign
IGL03175:Calr3 APN 8 72443605 missense probably damaging 1.00
R0140:Calr3 UTSW 8 72434888 splice site probably benign
R1518:Calr3 UTSW 8 72427200 missense probably damaging 0.97
R1675:Calr3 UTSW 8 72431458 missense probably damaging 1.00
R2006:Calr3 UTSW 8 72434851 missense probably damaging 1.00
R2111:Calr3 UTSW 8 72427268 missense probably damaging 0.99
R2202:Calr3 UTSW 8 72434839 missense probably damaging 1.00
R2432:Calr3 UTSW 8 72438426 unclassified probably benign
R3946:Calr3 UTSW 8 72443620 missense probably damaging 1.00
R4382:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4383:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4384:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4385:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4943:Calr3 UTSW 8 72431377 missense probably benign 0.18
R5132:Calr3 UTSW 8 72431368 splice site probably null
R7337:Calr3 UTSW 8 72431495 missense probably damaging 1.00
R7879:Calr3 UTSW 8 72424643 missense unknown
R7962:Calr3 UTSW 8 72424643 missense unknown
Predicted Primers PCR Primer
(F):5'- AACTTATTGCAGACCCTGGG -3'
(R):5'- AGCATTCTACCAATTGAGCTACAAG -3'

Sequencing Primer
(F):5'- CCCTGGGGTCATAGGGGTCTATAG -3'
(R):5'- AGCACTCTATTATATGAGTCCCAGC -3'
Posted On2014-10-30