Incidental Mutation 'R0279:Kcnk2'
ID24518
Institutional Source Beutler Lab
Gene Symbol Kcnk2
Ensembl Gene ENSMUSG00000037624
Gene Namepotassium channel, subfamily K, member 2
SynonymsTREK-1
MMRRC Submission 038501-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0279 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location189207930-189402273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 189209972 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 352 (A352T)
Ref Sequence ENSEMBL: ENSMUSP00000141849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079451] [ENSMUST00000110920] [ENSMUST00000180044] [ENSMUST00000192723] [ENSMUST00000193319] [ENSMUST00000194172] [ENSMUST00000194402]
Predicted Effect probably benign
Transcript: ENSMUST00000079451
AA Change: A355T

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078416
Gene: ENSMUSG00000037624
AA Change: A355T

DomainStartEndE-ValueType
Pfam:Ion_trans_2 117 197 2e-20 PFAM
low complexity region 221 230 N/A INTRINSIC
Pfam:Ion_trans_2 233 313 6.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110920
AA Change: A352T

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106545
Gene: ENSMUSG00000037624
AA Change: A352T

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180044
SMART Domains Protein: ENSMUSP00000136513
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192529
Predicted Effect possibly damaging
Transcript: ENSMUST00000192723
AA Change: A352T

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141849
Gene: ENSMUSG00000037624
AA Change: A352T

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193319
AA Change: A367T

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141891
Gene: ENSMUSG00000037624
AA Change: A367T

DomainStartEndE-ValueType
Pfam:Ion_trans_2 117 198 2.5e-21 PFAM
Pfam:Ion_trans_2 226 313 3.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193686
Predicted Effect probably benign
Transcript: ENSMUST00000194172
SMART Domains Protein: ENSMUSP00000142176
Gene: ENSMUSG00000037624

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
Pfam:Ion_trans_2 113 194 5e-20 PFAM
low complexity region 216 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194402
AA Change: A363T

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142026
Gene: ENSMUSG00000037624
AA Change: A363T

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
Pfam:Ion_trans_2 113 194 1.4e-19 PFAM
Pfam:Ion_trans_2 222 309 2.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194444
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the two-pore-domain background potassium channel protein family. This type of potassium channel is formed by two homodimers that create a channel that leaks potassium out of the cell to control resting membrane potential. The channel can be opened, however, by certain anesthetics, membrane stretching, intracellular acidosis, and heat. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased sensitivity to pharmacologically induced seizures and ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610528J11Rik A T 4: 118,529,293 M1L probably benign Het
5730596B20Rik T A 6: 52,179,202 probably benign Het
Acrbp T C 6: 125,053,954 probably null Het
Acss3 A G 10: 107,084,871 I126T possibly damaging Het
Aff3 T C 1: 38,535,569 E110G probably damaging Het
Aldh1a3 T C 7: 66,409,252 I113V probably benign Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Atp2b4 A G 1: 133,729,702 probably benign Het
Atp8a1 C T 5: 67,813,092 probably null Het
Bhmt A G 13: 93,625,464 C104R probably damaging Het
Ccdc151 A G 9: 21,990,247 probably benign Het
Cct5 T G 15: 31,591,031 E508A probably damaging Het
Celsr1 T A 15: 85,902,864 E2761D probably benign Het
Clstn1 T C 4: 149,643,674 S600P probably damaging Het
Cnppd1 A G 1: 75,136,929 S232P probably damaging Het
Crybb3 T C 5: 113,079,753 probably null Het
Csmd1 A G 8: 16,223,235 I861T probably damaging Het
Cyp2d10 A C 15: 82,405,339 S191A possibly damaging Het
Ddx10 T C 9: 53,235,304 D206G probably damaging Het
Dnah1 G T 14: 31,302,375 H916N possibly damaging Het
Dnah9 A G 11: 65,911,789 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Etnppl A G 3: 130,629,413 R248G probably damaging Het
Eya3 T C 4: 132,719,247 F369L probably damaging Het
Fam129a T C 1: 151,709,206 probably null Het
Fam170b T C 14: 32,834,068 probably benign Het
Fli1 A T 9: 32,461,427 V105D probably damaging Het
Fmo1 T C 1: 162,830,272 I433M possibly damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Foxe3 T C 4: 114,925,568 D149G probably damaging Het
Gk5 T C 9: 96,174,804 probably benign Het
Gm14226 A G 2: 155,025,452 D443G possibly damaging Het
Gm9796 C T 11: 95,697,995 noncoding transcript Het
Golga4 A T 9: 118,568,993 R52S probably benign Het
Hey2 C A 10: 30,834,010 C249F probably damaging Het
Ipo9 A T 1: 135,420,363 probably benign Het
Ireb2 C A 9: 54,886,593 T269K probably benign Het
Kansl3 A G 1: 36,351,969 V274A probably damaging Het
Lamc2 T C 1: 153,130,696 E903G probably benign Het
Lepr A G 4: 101,750,344 K253R probably benign Het
Lmntd2 T C 7: 141,213,623 probably benign Het
Lrrc39 A T 3: 116,578,303 T240S probably benign Het
Lrrc43 A G 5: 123,497,022 probably null Het
Maf T C 8: 115,705,756 M370V possibly damaging Het
Mib2 G A 4: 155,661,216 S46L possibly damaging Het
Mms22l C T 4: 24,497,867 T63I probably damaging Het
Morc2a T A 11: 3,683,989 S700R probably benign Het
Mpz A G 1: 171,159,929 probably benign Het
Ncam2 T C 16: 81,623,337 probably benign Het
Nudt14 C T 12: 112,938,417 A123T probably damaging Het
Olfr1016 A T 2: 85,799,535 I245N possibly damaging Het
Olfr13 G A 6: 43,174,758 M257I probably benign Het
Olfr239 C T 17: 33,199,324 T92I probably benign Het
Otoa T C 7: 121,111,079 probably benign Het
Pik3cg G A 12: 32,204,791 T399I probably damaging Het
Pkn3 C T 2: 30,083,297 A377V probably benign Het
Ppan A G 9: 20,891,529 N327S probably benign Het
Prkca T C 11: 108,054,111 probably benign Het
Prrc2c A T 1: 162,715,464 V320E probably damaging Het
Ptprq A G 10: 107,608,417 V1442A probably damaging Het
Rapgef1 C T 2: 29,726,227 R834C probably damaging Het
Rbms1 G T 2: 60,842,410 N44K probably damaging Het
Rfwd3 A C 8: 111,282,733 F404V probably benign Het
Rimbp3 G T 16: 17,209,453 R247L probably benign Het
Serpinb1b T C 13: 33,093,713 S310P possibly damaging Het
Smtn C A 11: 3,530,235 V329L probably damaging Het
Snapc2 T C 8: 4,254,979 probably benign Het
Spam1 A T 6: 24,800,419 M386L probably benign Het
Syne2 A G 12: 76,095,613 E6208G probably damaging Het
Teddm1a T C 1: 153,892,623 Y278H probably damaging Het
Tnfaip6 A T 2: 52,055,916 N258I possibly damaging Het
Trpm4 C T 7: 45,322,048 R188Q probably damaging Het
Ttbk2 A T 2: 120,748,960 H491Q probably benign Het
Urgcp C T 11: 5,716,989 E450K probably benign Het
Vmn1r228 T C 17: 20,776,375 N294D probably benign Het
Wdfy3 A T 5: 101,868,092 C2606S probably damaging Het
Wdr33 T A 18: 31,888,324 H642Q unknown Het
Zbtb46 A G 2: 181,411,774 S382P possibly damaging Het
Zfp217 A G 2: 170,119,780 I209T probably benign Het
Zranb3 T A 1: 127,963,773 N822I probably benign Het
Other mutations in Kcnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnk2 APN 1 189243014 missense probably damaging 0.96
IGL01100:Kcnk2 APN 1 189339936 missense probably damaging 1.00
IGL01872:Kcnk2 APN 1 189256583 missense probably damaging 1.00
IGL01929:Kcnk2 APN 1 189340030 missense probably damaging 1.00
IGL02643:Kcnk2 APN 1 189258779 missense possibly damaging 0.63
IGL03056:Kcnk2 APN 1 189295711 missense possibly damaging 0.82
IGL03340:Kcnk2 APN 1 189295681 missense possibly damaging 0.51
R0041:Kcnk2 UTSW 1 189295691 missense probably benign 0.44
R0041:Kcnk2 UTSW 1 189295691 missense probably benign 0.44
R0569:Kcnk2 UTSW 1 189339801 missense probably damaging 1.00
R0645:Kcnk2 UTSW 1 189256730 intron probably null
R1070:Kcnk2 UTSW 1 189256763 splice site probably benign
R1449:Kcnk2 UTSW 1 189340026 missense probably benign 0.31
R2401:Kcnk2 UTSW 1 189340017 missense possibly damaging 0.64
R4418:Kcnk2 UTSW 1 189256727 missense probably damaging 1.00
R4923:Kcnk2 UTSW 1 189339936 missense probably damaging 1.00
R5782:Kcnk2 UTSW 1 189256579 missense probably damaging 1.00
R5845:Kcnk2 UTSW 1 189277721 intron probably benign
R6140:Kcnk2 UTSW 1 189209907 missense probably damaging 0.97
R6240:Kcnk2 UTSW 1 189242982 missense probably damaging 1.00
R6881:Kcnk2 UTSW 1 189209990 missense probably benign 0.00
R8046:Kcnk2 UTSW 1 189258736 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- TGACAGCTATGTCCTCACCAGCAC -3'
(R):5'- GTCACTGTGAGAGCATAGACAGCC -3'

Sequencing Primer
(F):5'- CAGCACAGTGTGGTGTCAG -3'
(R):5'- CACAAGATGTAGCTCCCATGTTG -3'
Posted On2013-04-16