Incidental Mutation 'R2296:Fam13b'
ID 245188
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Name family with sequence similarity 13, member B
Synonyms 2610024E20Rik
MMRRC Submission 040295-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock # R2296 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 34442352-34506823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34494761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 129 (D129G)
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040506]
AlphaFold Q8K2H3
Predicted Effect possibly damaging
Transcript: ENSMUST00000040506
AA Change: D129G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501
AA Change: D129G

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,512,051 E68G possibly damaging Het
Apob A G 12: 7,994,879 D820G probably damaging Het
Bglap3 G C 3: 88,369,512 probably benign Het
Calr3 C T 8: 72,424,625 probably benign Het
Carmil1 A G 13: 24,115,509 L344P probably damaging Het
Cop1 G A 1: 159,244,650 V109M possibly damaging Het
Dennd4b T A 3: 90,275,514 N879K probably damaging Het
Fam222a C A 5: 114,610,966 H74Q possibly damaging Het
Gata5 A G 2: 180,328,320 M278T possibly damaging Het
Gm4951 T A 18: 60,245,470 C26S probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Inpp5k T G 11: 75,639,487 L251R probably damaging Het
Lrrc36 T G 8: 105,461,019 D522E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nras T A 3: 103,059,034 probably null Het
Nudt12 A G 17: 59,010,049 V201A possibly damaging Het
Phf2 T C 13: 48,835,278 E39G unknown Het
Serpinb3a A T 1: 107,047,561 V172D probably damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Trim3 A G 7: 105,613,274 I559T probably damaging Het
Trp53bp1 A T 2: 121,209,247 S1304T possibly damaging Het
Xrcc5 A T 1: 72,346,326 K525N probably benign Het
Zfp110 T A 7: 12,849,540 V705D probably damaging Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34487096 missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34454718 missense probably damaging 1.00
IGL00556:Fam13b APN 18 34497435 missense probably damaging 0.99
IGL02123:Fam13b APN 18 34445618 unclassified probably benign
IGL02313:Fam13b APN 18 34454656 missense probably damaging 1.00
IGL02346:Fam13b APN 18 34462105 missense probably benign 0.00
IGL02347:Fam13b APN 18 34454704 missense probably damaging 1.00
IGL02694:Fam13b APN 18 34451206 critical splice donor site probably null
IGL03347:Fam13b APN 18 34462051 splice site probably benign
R0109:Fam13b UTSW 18 34451308 missense probably benign 0.00
R0233:Fam13b UTSW 18 34448084 missense probably damaging 1.00
R0455:Fam13b UTSW 18 34445528 unclassified probably benign
R1229:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1397:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1571:Fam13b UTSW 18 34497432 missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34451439 critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34487134 missense probably benign 0.04
R1777:Fam13b UTSW 18 34457760 missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34445329 missense possibly damaging 0.69
R3881:Fam13b UTSW 18 34462059 critical splice donor site probably null
R3896:Fam13b UTSW 18 34462955 splice site probably benign
R5277:Fam13b UTSW 18 34462190 missense probably benign
R5759:Fam13b UTSW 18 34497435 missense probably damaging 0.99
R5817:Fam13b UTSW 18 34457797 missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34454081 missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34497405 missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34494774 missense probably damaging 1.00
R6087:Fam13b UTSW 18 34487139 missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34494277 missense probably damaging 0.96
R6454:Fam13b UTSW 18 34457662 critical splice donor site probably null
R6464:Fam13b UTSW 18 34473631 nonsense probably null
R6679:Fam13b UTSW 18 34487022 missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34498026 missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34497447 missense possibly damaging 0.92
R7420:Fam13b UTSW 18 34494611 missense probably damaging 1.00
R7517:Fam13b UTSW 18 34494607 missense probably damaging 0.98
R7534:Fam13b UTSW 18 34498007 missense probably damaging 0.97
R7889:Fam13b UTSW 18 34457691 missense probably benign 0.00
R8139:Fam13b UTSW 18 34473633 missense possibly damaging 0.50
R8776:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8826:Fam13b UTSW 18 34498017 missense probably damaging 0.96
R9166:Fam13b UTSW 18 34462199 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AACTTACTGGAAGACATCTGGAC -3'
(R):5'- GGGCTGAGTCCTTTATCTCCAC -3'

Sequencing Primer
(F):5'- TGGAAGACATCTGGACCAAAAAC -3'
(R):5'- TCACTTAATAAGGGAAATGCAAAGCC -3'
Posted On 2014-10-30