Incidental Mutation 'R2296:Gm4951'
ID245189
Institutional Source Beutler Lab
Gene Symbol Gm4951
Ensembl Gene ENSMUSG00000073555
Gene Namepredicted gene 4951
Synonyms
MMRRC Submission 040295-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2296 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location60212080-60247820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60245470 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 26 (C26S)
Ref Sequence ENSEMBL: ENSMUSP00000031549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031549]
Predicted Effect probably benign
Transcript: ENSMUST00000031549
AA Change: C26S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031549
Gene: ENSMUSG00000073555
AA Change: C26S

DomainStartEndE-ValueType
Pfam:IIGP 34 402 4.8e-157 PFAM
Pfam:MMR_HSR1 70 198 2.8e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A G 1: 11,512,051 E68G possibly damaging Het
Apob A G 12: 7,994,879 D820G probably damaging Het
Bglap3 G C 3: 88,369,512 probably benign Het
Calr3 C T 8: 72,424,625 probably benign Het
Carmil1 A G 13: 24,115,509 L344P probably damaging Het
Cop1 G A 1: 159,244,650 V109M possibly damaging Het
Dennd4b T A 3: 90,275,514 N879K probably damaging Het
Fam13b T C 18: 34,494,761 D129G possibly damaging Het
Fam222a C A 5: 114,610,966 H74Q possibly damaging Het
Gata5 A G 2: 180,328,320 M278T possibly damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Inpp5k T G 11: 75,639,487 L251R probably damaging Het
Lrrc36 T G 8: 105,461,019 D522E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nras T A 3: 103,059,034 probably null Het
Nudt12 A G 17: 59,010,049 V201A possibly damaging Het
Phf2 T C 13: 48,835,278 E39G unknown Het
Serpinb3a A T 1: 107,047,561 V172D probably damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Trim3 A G 7: 105,613,274 I559T probably damaging Het
Trp53bp1 A T 2: 121,209,247 S1304T possibly damaging Het
Xrcc5 A T 1: 72,346,326 K525N probably benign Het
Zfp110 T A 7: 12,849,540 V705D probably damaging Het
Other mutations in Gm4951
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Gm4951 APN 18 60246293 missense probably damaging 1.00
IGL00807:Gm4951 APN 18 60245411 missense probably damaging 1.00
IGL00956:Gm4951 APN 18 60246190 missense probably damaging 1.00
IGL01017:Gm4951 APN 18 60245436 missense possibly damaging 0.87
IGL01929:Gm4951 APN 18 60246482 missense probably benign 0.02
IGL02267:Gm4951 APN 18 60246398 missense probably damaging 0.97
IGL02276:Gm4951 APN 18 60246079 missense probably damaging 0.99
IGL02499:Gm4951 APN 18 60245638 missense probably damaging 1.00
IGL02538:Gm4951 APN 18 60245872 nonsense probably null
IGL03139:Gm4951 APN 18 60246149 missense probably benign 0.01
IGL03209:Gm4951 APN 18 60246071 missense probably damaging 1.00
IGL03270:Gm4951 APN 18 60245476 missense probably benign 0.01
IGL03325:Gm4951 APN 18 60245811 nonsense probably null
Carboniferous UTSW 18 60245768 missense probably damaging 1.00
Oily UTSW 18 60245652 missense probably damaging 1.00
R0554:Gm4951 UTSW 18 60245417 missense probably benign 0.15
R2046:Gm4951 UTSW 18 60245499 missense probably benign 0.00
R4583:Gm4951 UTSW 18 60246080 missense possibly damaging 0.93
R5500:Gm4951 UTSW 18 60246020 missense probably damaging 0.99
R5532:Gm4951 UTSW 18 60246070 missense probably benign 0.23
R5938:Gm4951 UTSW 18 60245652 missense probably damaging 1.00
R6446:Gm4951 UTSW 18 60245768 missense probably damaging 1.00
R7191:Gm4951 UTSW 18 60246257 missense probably benign 0.01
R7238:Gm4951 UTSW 18 60246283 missense possibly damaging 0.64
R7443:Gm4951 UTSW 18 60246050 missense probably benign 0.11
Z1177:Gm4951 UTSW 18 60246296 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGTGATGGTCTCAGCTACCTG -3'
(R):5'- AAGCTGGACTTCCCTGATCCAG -3'

Sequencing Primer
(F):5'- TGGTCTCAGCTACCTGCAGAAAG -3'
(R):5'- ATCCAGTCTCCCCGGTGAGAG -3'
Posted On2014-10-30