Incidental Mutation 'R2297:Galnt12'
ID245197
Institutional Source Beutler Lab
Gene Symbol Galnt12
Ensembl Gene ENSMUSG00000039774
Gene Namepolypeptide N-acetylgalactosaminyltransferase 12
Synonyms
MMRRC Submission 040296-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2297 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location47091909-47123070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47113834 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 84 (V84D)
Ref Sequence ENSEMBL: ENSMUSP00000103373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045041] [ENSMUST00000107744]
Predicted Effect probably damaging
Transcript: ENSMUST00000045041
AA Change: V376D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045721
Gene: ENSMUSG00000039774
AA Change: V376D

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 131 375 3.4e-10 PFAM
Pfam:Glycos_transf_2 134 317 1.4e-35 PFAM
Pfam:Glyco_tranf_2_2 134 360 6.6e-8 PFAM
Pfam:Glyco_transf_7C 290 363 3e-9 PFAM
RICIN 440 572 8.09e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107744
AA Change: V84D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103373
Gene: ENSMUSG00000039774
AA Change: V84D

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 5 71 7.5e-9 PFAM
RICIN 148 280 8.09e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases, which catalyze the transfer of N-acetylgalactosamine (GalNAc) from UDP-GalNAc to a serine or threonine residue on a polypeptide acceptor in the initial step of O-linked protein glycosylation. Mutations in this gene are associated with an increased susceptibility to colorectal cancer.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik G A 11: 3,890,127 A90V probably damaging Het
Aco2 A T 15: 81,903,908 D114V probably damaging Het
Cop1 C T 1: 159,252,554 H185Y possibly damaging Het
Cyp2a12 A G 7: 27,034,632 D330G possibly damaging Het
Dcaf6 T C 1: 165,399,862 Y232C probably damaging Het
Ddx42 T G 11: 106,242,939 D580E probably damaging Het
Dtl A G 1: 191,541,095 V567A probably benign Het
Fem1c T C 18: 46,506,161 K258R possibly damaging Het
Grm1 T G 10: 11,080,414 D42A probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ncapd3 C T 9: 27,041,501 R109* probably null Het
Olfr368 A G 2: 37,332,143 N132S probably benign Het
Pimreg T C 11: 72,043,080 S11P probably damaging Het
Ppp1r16b G A 2: 158,761,366 E404K possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Slc6a11 A G 6: 114,131,425 N50S probably benign Het
Stab2 T A 10: 86,954,474 probably null Het
Tmem132d T C 5: 128,268,544 T305A possibly damaging Het
Tnfrsf13b A G 11: 61,147,445 T185A probably benign Het
Trdn C A 10: 33,335,012 P400Q probably damaging Het
Zfp119b T A 17: 55,939,355 Y277F possibly damaging Het
Other mutations in Galnt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Galnt12 APN 4 47112315 splice site probably benign
IGL02188:Galnt12 APN 4 47122521 missense probably damaging 1.00
IGL02217:Galnt12 APN 4 47113832 missense probably damaging 1.00
IGL02388:Galnt12 APN 4 47117941 missense probably damaging 1.00
IGL02550:Galnt12 APN 4 47104126 missense possibly damaging 0.47
IGL03062:Galnt12 APN 4 47122566 missense possibly damaging 0.80
R0508:Galnt12 UTSW 4 47104255 missense probably damaging 1.00
R1513:Galnt12 UTSW 4 47117956 missense probably damaging 1.00
R1634:Galnt12 UTSW 4 47108585 splice site probably null
R2072:Galnt12 UTSW 4 47108477 nonsense probably null
R3113:Galnt12 UTSW 4 47108415 missense probably benign 0.01
R3157:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3158:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3159:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3725:Galnt12 UTSW 4 47104140 missense probably damaging 1.00
R4284:Galnt12 UTSW 4 47104231 missense probably damaging 1.00
R4691:Galnt12 UTSW 4 47104143 missense probably damaging 1.00
R5134:Galnt12 UTSW 4 47113818 missense probably damaging 1.00
R5408:Galnt12 UTSW 4 47104169 missense probably damaging 1.00
R5657:Galnt12 UTSW 4 47104150 missense possibly damaging 0.95
R6074:Galnt12 UTSW 4 47112405 missense probably damaging 1.00
R6406:Galnt12 UTSW 4 47122534 missense probably benign 0.00
R6721:Galnt12 UTSW 4 47122529 nonsense probably null
R7287:Galnt12 UTSW 4 47108525 missense probably damaging 1.00
R7407:Galnt12 UTSW 4 47120362 missense probably damaging 1.00
R7512:Galnt12 UTSW 4 47108406 missense possibly damaging 0.83
R7810:Galnt12 UTSW 4 47113786 missense probably damaging 1.00
R8823:Galnt12 UTSW 4 47091928 start gained probably benign
R8871:Galnt12 UTSW 4 47108582 critical splice donor site probably null
X0025:Galnt12 UTSW 4 47104166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAGTGCATGAGCTGTAGCC -3'
(R):5'- CCTAAAGGTGTTTTCTCTGTGC -3'

Sequencing Primer
(F):5'- AGGTGCATGCCAGTCAGTG -3'
(R):5'- TCAGACATGAGTTCCAGTGC -3'
Posted On2014-10-30