Incidental Mutation 'R2297:Tnfrsf13b'
ID245208
Institutional Source Beutler Lab
Gene Symbol Tnfrsf13b
Ensembl Gene ENSMUSG00000010142
Gene Nametumor necrosis factor receptor superfamily, member 13b
SynonymsTaci, 1200009E08Rik
MMRRC Submission 040296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2297 (G1)
Quality Score185
Status Not validated
Chromosome11
Chromosomal Location61126755-61149372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61147445 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 185 (T185A)
Ref Sequence ENSEMBL: ENSMUSP00000098662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010286] [ENSMUST00000041683] [ENSMUST00000101103] [ENSMUST00000139422] [ENSMUST00000146033]
Predicted Effect probably benign
Transcript: ENSMUST00000010286
AA Change: T185A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010286
Gene: ENSMUSG00000010142
AA Change: T185A

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 79 1.7e-24 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041683
SMART Domains Protein: ENSMUSP00000041263
Gene: ENSMUSG00000042506

DomainStartEndE-ValueType
Pfam:zf-UBP 63 124 5.5e-16 PFAM
Pfam:UCH 175 517 5.5e-60 PFAM
Pfam:UCH_1 176 501 2.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101103
AA Change: T185A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098662
Gene: ENSMUSG00000010142
AA Change: T185A

DomainStartEndE-ValueType
internal_repeat_1 6 39 6.78e-5 PROSPERO
Pfam:TACI-CRD2 41 81 2.6e-33 PFAM
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137832
Predicted Effect probably benign
Transcript: ENSMUST00000139422
SMART Domains Protein: ENSMUSP00000116175
Gene: ENSMUSG00000010142

DomainStartEndE-ValueType
internal_repeat_1 6 39 1.03e-5 PROSPERO
Pfam:TACI-CRD2 41 81 9.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146033
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lymphocyte-specific member of the tumor necrosis factor (TNF) receptor superfamily. It interacts with calcium-modulator and cyclophilin ligand (CAML). The protein induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show increased B cell numbers and splenomegaly. Homozygotes for a null allele show impaired T cell-independent immune responses and isotype switching. Homozygotes for another null allele develop lymphoproliferation and fatal autoimmune nephritis with high titers of autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik G A 11: 3,890,127 A90V probably damaging Het
Aco2 A T 15: 81,903,908 D114V probably damaging Het
Cop1 C T 1: 159,252,554 H185Y possibly damaging Het
Cyp2a12 A G 7: 27,034,632 D330G possibly damaging Het
Dcaf6 T C 1: 165,399,862 Y232C probably damaging Het
Ddx42 T G 11: 106,242,939 D580E probably damaging Het
Dtl A G 1: 191,541,095 V567A probably benign Het
Fem1c T C 18: 46,506,161 K258R possibly damaging Het
Galnt12 T A 4: 47,113,834 V84D probably damaging Het
Grm1 T G 10: 11,080,414 D42A probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ncapd3 C T 9: 27,041,501 R109* probably null Het
Olfr368 A G 2: 37,332,143 N132S probably benign Het
Pimreg T C 11: 72,043,080 S11P probably damaging Het
Ppp1r16b G A 2: 158,761,366 E404K possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Slc6a11 A G 6: 114,131,425 N50S probably benign Het
Stab2 T A 10: 86,954,474 probably null Het
Tmem132d T C 5: 128,268,544 T305A possibly damaging Het
Trdn C A 10: 33,335,012 P400Q probably damaging Het
Zfp119b T A 17: 55,939,355 Y277F possibly damaging Het
Other mutations in Tnfrsf13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Tnfrsf13b APN 11 61141320 missense possibly damaging 0.51
R0523:Tnfrsf13b UTSW 11 61147587 missense probably benign 0.33
R2517:Tnfrsf13b UTSW 11 61141476 missense probably benign 0.27
R4298:Tnfrsf13b UTSW 11 61140817 splice site probably null
R4299:Tnfrsf13b UTSW 11 61140817 splice site probably null
R4454:Tnfrsf13b UTSW 11 61141438 missense probably benign 0.33
R4931:Tnfrsf13b UTSW 11 61140937 missense possibly damaging 0.66
R5416:Tnfrsf13b UTSW 11 61147023 splice site probably null
RF013:Tnfrsf13b UTSW 11 61141444 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCTTTGAGAGGAGATCGG -3'
(R):5'- TTTCGGGCTGTCAAGTTGCC -3'

Sequencing Primer
(F):5'- ATCGGGAAGCGGGTTACC -3'
(R):5'- TGTCAAGTTGCCGGACGAG -3'
Posted On2014-10-30