Incidental Mutation 'R2297:Aco2'
ID245211
Institutional Source Beutler Lab
Gene Symbol Aco2
Ensembl Gene ENSMUSG00000022477
Gene Nameaconitase 2, mitochondrial
SynonymsAco-2, Aco3, D10Wsu183e
MMRRC Submission 040296-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R2297 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81872309-81915133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81903908 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 114 (D114V)
Ref Sequence ENSEMBL: ENSMUSP00000155818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023116] [ENSMUST00000229068]
Predicted Effect probably damaging
Transcript: ENSMUST00000023116
AA Change: D246V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023116
Gene: ENSMUSG00000022477
AA Change: D246V

DomainStartEndE-ValueType
Pfam:Aconitase 65 503 2.2e-160 PFAM
Pfam:Aconitase_C 582 712 5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155704
Predicted Effect probably damaging
Transcript: ENSMUST00000229068
AA Change: D114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231075
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aconitase/IPM isomerase family. It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. This protein is encoded in the nucleus and functions in the mitochondrion. It was found to be one of the mitochondrial matrix proteins that are preferentially degraded by the serine protease 15(PRSS15), also known as Lon protease, after oxidative modification. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik G A 11: 3,890,127 A90V probably damaging Het
Cop1 C T 1: 159,252,554 H185Y possibly damaging Het
Cyp2a12 A G 7: 27,034,632 D330G possibly damaging Het
Dcaf6 T C 1: 165,399,862 Y232C probably damaging Het
Ddx42 T G 11: 106,242,939 D580E probably damaging Het
Dtl A G 1: 191,541,095 V567A probably benign Het
Fem1c T C 18: 46,506,161 K258R possibly damaging Het
Galnt12 T A 4: 47,113,834 V84D probably damaging Het
Grm1 T G 10: 11,080,414 D42A probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ncapd3 C T 9: 27,041,501 R109* probably null Het
Olfr368 A G 2: 37,332,143 N132S probably benign Het
Pimreg T C 11: 72,043,080 S11P probably damaging Het
Ppp1r16b G A 2: 158,761,366 E404K possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Slc6a11 A G 6: 114,131,425 N50S probably benign Het
Stab2 T A 10: 86,954,474 probably null Het
Tmem132d T C 5: 128,268,544 T305A possibly damaging Het
Tnfrsf13b A G 11: 61,147,445 T185A probably benign Het
Trdn C A 10: 33,335,012 P400Q probably damaging Het
Zfp119b T A 17: 55,939,355 Y277F possibly damaging Het
Other mutations in Aco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Aco2 APN 15 81913714 missense possibly damaging 0.88
IGL02450:Aco2 APN 15 81914762 makesense probably null
IGL03408:Aco2 APN 15 81899223 critical splice donor site probably null
ANU22:Aco2 UTSW 15 81913714 missense possibly damaging 0.88
R0066:Aco2 UTSW 15 81903465 splice site probably benign
R0066:Aco2 UTSW 15 81903465 splice site probably benign
R0254:Aco2 UTSW 15 81889356 missense probably damaging 0.99
R0408:Aco2 UTSW 15 81913118 splice site probably null
R0535:Aco2 UTSW 15 81913217 missense possibly damaging 0.76
R0839:Aco2 UTSW 15 81907535 splice site probably null
R1199:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1201:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1320:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1321:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1322:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R2082:Aco2 UTSW 15 81913695 missense possibly damaging 0.83
R2275:Aco2 UTSW 15 81895264 missense probably benign 0.37
R4414:Aco2 UTSW 15 81889383 splice site probably null
R4497:Aco2 UTSW 15 81895285 missense probably damaging 1.00
R4498:Aco2 UTSW 15 81895285 missense probably damaging 1.00
R4708:Aco2 UTSW 15 81909916 critical splice donor site probably null
R5556:Aco2 UTSW 15 81889319 missense probably damaging 1.00
R5568:Aco2 UTSW 15 81903586 missense probably damaging 0.99
R6103:Aco2 UTSW 15 81913251 missense probably benign 0.00
R6912:Aco2 UTSW 15 81895396 missense probably benign
R7319:Aco2 UTSW 15 81903619 missense probably damaging 1.00
R7552:Aco2 UTSW 15 81903941 missense probably damaging 1.00
R7585:Aco2 UTSW 15 81872484 unclassified probably benign
R8792:Aco2 UTSW 15 81909496 missense probably damaging 1.00
R8838:Aco2 UTSW 15 81911927 missense probably damaging 0.97
R8957:Aco2 UTSW 15 81889500 intron probably benign
Z1177:Aco2 UTSW 15 81895310 missense probably damaging 1.00
Z1177:Aco2 UTSW 15 81895312 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCCAGGCTAGATTCTCTTTTG -3'
(R):5'- TATTCTCAGCCCACACTGTTGG -3'

Sequencing Primer
(F):5'- CCAGGCTAGATTCTCTTTTGTGAGG -3'
(R):5'- CAGGGGAAGACCACCTTAACTACTG -3'
Posted On2014-10-30