Incidental Mutation 'R2297:Zfp119b'
ID245212
Institutional Source Beutler Lab
Gene Symbol Zfp119b
Ensembl Gene ENSMUSG00000062101
Gene Namezinc finger protein 119b
SynonymsBC031441
MMRRC Submission 040296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2297 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location55938381-55949500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55939355 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 277 (Y277F)
Ref Sequence ENSEMBL: ENSMUSP00000058300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056147] [ENSMUST00000189452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056147
AA Change: Y277F

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058300
Gene: ENSMUSG00000062101
AA Change: Y277F

DomainStartEndE-ValueType
KRAB 4 56 2e-14 SMART
ZnF_C2H2 155 175 2.82e1 SMART
ZnF_C2H2 287 309 1.1e-2 SMART
ZnF_C2H2 315 337 2.24e-3 SMART
ZnF_C2H2 343 365 5.14e-3 SMART
ZnF_C2H2 371 393 4.79e-3 SMART
ZnF_C2H2 399 421 1.12e-3 SMART
ZnF_C2H2 427 449 5.14e-3 SMART
ZnF_C2H2 455 477 7.37e-4 SMART
ZnF_C2H2 483 505 4.87e-4 SMART
ZnF_C2H2 511 533 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189452
AA Change: Y245F

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139791
Gene: ENSMUSG00000062101
AA Change: Y245F

DomainStartEndE-ValueType
Blast:KRAB 1 34 8e-11 BLAST
ZnF_C2H2 123 143 1.2e-1 SMART
ZnF_C2H2 255 277 4.7e-5 SMART
ZnF_C2H2 283 305 9.1e-6 SMART
ZnF_C2H2 311 333 2.2e-5 SMART
ZnF_C2H2 339 361 2e-5 SMART
ZnF_C2H2 367 389 4.7e-6 SMART
ZnF_C2H2 395 417 2.1e-5 SMART
ZnF_C2H2 423 445 3.2e-6 SMART
ZnF_C2H2 451 473 2e-6 SMART
ZnF_C2H2 479 501 5.2e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik G A 11: 3,890,127 A90V probably damaging Het
Aco2 A T 15: 81,903,908 D114V probably damaging Het
Cop1 C T 1: 159,252,554 H185Y possibly damaging Het
Cyp2a12 A G 7: 27,034,632 D330G possibly damaging Het
Dcaf6 T C 1: 165,399,862 Y232C probably damaging Het
Ddx42 T G 11: 106,242,939 D580E probably damaging Het
Dtl A G 1: 191,541,095 V567A probably benign Het
Fem1c T C 18: 46,506,161 K258R possibly damaging Het
Galnt12 T A 4: 47,113,834 V84D probably damaging Het
Grm1 T G 10: 11,080,414 D42A probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ncapd3 C T 9: 27,041,501 R109* probably null Het
Olfr368 A G 2: 37,332,143 N132S probably benign Het
Pimreg T C 11: 72,043,080 S11P probably damaging Het
Ppp1r16b G A 2: 158,761,366 E404K possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Slc6a11 A G 6: 114,131,425 N50S probably benign Het
Stab2 T A 10: 86,954,474 probably null Het
Tmem132d T C 5: 128,268,544 T305A possibly damaging Het
Tnfrsf13b A G 11: 61,147,445 T185A probably benign Het
Trdn C A 10: 33,335,012 P400Q probably damaging Het
Other mutations in Zfp119b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Zfp119b APN 17 55939270 missense probably damaging 1.00
IGL01868:Zfp119b APN 17 55939866 missense possibly damaging 0.70
IGL02623:Zfp119b APN 17 55939793 missense probably damaging 0.96
R0377:Zfp119b UTSW 17 55938671 missense probably damaging 1.00
R1833:Zfp119b UTSW 17 55939271 missense probably damaging 1.00
R2177:Zfp119b UTSW 17 55938639 missense probably damaging 1.00
R4273:Zfp119b UTSW 17 55938926 missense possibly damaging 0.79
R4801:Zfp119b UTSW 17 55939642 missense probably damaging 0.96
R4802:Zfp119b UTSW 17 55939642 missense probably damaging 0.96
R6525:Zfp119b UTSW 17 55939992 missense possibly damaging 0.96
R6644:Zfp119b UTSW 17 55939148 missense probably benign 0.21
R6950:Zfp119b UTSW 17 55939137 missense probably damaging 1.00
R6974:Zfp119b UTSW 17 55938564 missense probably benign 0.02
R7750:Zfp119b UTSW 17 55938682 missense probably damaging 1.00
R8882:Zfp119b UTSW 17 55939923 missense possibly damaging 0.84
RF020:Zfp119b UTSW 17 55939499 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCATTTCTTAGATTGCTGGGGAAT -3'
(R):5'- GCCACACCGAAGAACTCATT -3'

Sequencing Primer
(F):5'- CCCACACTGATTGCATTTATAGGG -3'
(R):5'- CACACCGAAGAACTCATTTGGGAATG -3'
Posted On2014-10-30