Incidental Mutation 'R2298:1700030K09Rik'
ID 245226
Institutional Source Beutler Lab
Gene Symbol 1700030K09Rik
Ensembl Gene ENSMUSG00000052794
Gene Name RIKEN cDNA 1700030K09 gene
Synonyms
MMRRC Submission 040297-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R2298 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 73197724-73214385 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73209247 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 459 (D459G)
Ref Sequence ENSEMBL: ENSMUSP00000063244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064853] [ENSMUST00000121902]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000064853
AA Change: D459G

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000063244
Gene: ENSMUSG00000052794
AA Change: D459G

DomainStartEndE-ValueType
low complexity region 200 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
low complexity region 320 333 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 421 432 N/A INTRINSIC
Pfam:DUF4614 438 608 2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121902
AA Change: D425G

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113279
Gene: ENSMUSG00000052794
AA Change: D425G

DomainStartEndE-ValueType
low complexity region 200 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
low complexity region 320 333 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
Pfam:DUF4614 400 575 1.3e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139130
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 C A 2: 150,743,414 (GRCm39) probably benign Het
Atcay A T 10: 81,046,397 (GRCm39) I309N probably damaging Het
Capn8 T C 1: 182,440,985 (GRCm39) V473A probably benign Het
Cramp1 T C 17: 25,216,454 (GRCm39) I220V probably damaging Het
Creb3l1 G A 2: 91,822,321 (GRCm39) P222S probably damaging Het
Crocc G A 4: 140,752,770 (GRCm39) A1374V probably benign Het
Crybg1 A G 10: 43,875,218 (GRCm39) L630S probably damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Erbb4 C T 1: 68,081,690 (GRCm39) D1115N probably damaging Het
Fasn T A 11: 120,704,642 (GRCm39) L1314F possibly damaging Het
Galm T A 17: 80,489,126 (GRCm39) C84* probably null Het
H3f3a C T 1: 180,630,703 (GRCm39) R117H probably benign Het
Klf13 T C 7: 63,541,504 (GRCm39) K208E probably damaging Het
Kremen1 AGGCGG AGGCGGCGG 11: 5,151,788 (GRCm39) probably benign Het
Lgmn A G 12: 102,361,937 (GRCm39) F388S probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Msh2 T A 17: 88,015,930 (GRCm39) Y521N probably damaging Het
Myo5b G T 18: 74,758,676 (GRCm39) R219L probably damaging Het
Myzap A T 9: 71,456,039 (GRCm39) M327K probably damaging Het
Ngfr AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 95,478,316 (GRCm39) probably benign Het
Phf8-ps T C 17: 33,285,752 (GRCm39) E350G probably damaging Het
Rps6ka5 A G 12: 100,517,713 (GRCm39) F796S probably damaging Het
Srl T C 16: 4,300,762 (GRCm39) I332V probably damaging Het
Stab2 T A 10: 86,790,338 (GRCm39) probably null Het
Tenm2 T C 11: 35,937,604 (GRCm39) T1690A possibly damaging Het
Traf4 T A 11: 78,051,677 (GRCm39) D241V probably benign Het
Trpv6 A G 6: 41,613,010 (GRCm39) I52T possibly damaging Het
Zfp768 T A 7: 126,943,361 (GRCm39) M256L probably benign Het
Other mutations in 1700030K09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:1700030K09Rik APN 8 73,209,193 (GRCm39) missense probably damaging 1.00
IGL01010:1700030K09Rik APN 8 73,199,059 (GRCm39) missense probably damaging 0.98
IGL01449:1700030K09Rik APN 8 73,198,693 (GRCm39) missense probably benign 0.10
IGL01714:1700030K09Rik APN 8 73,209,413 (GRCm39) critical splice donor site probably null
IGL03256:1700030K09Rik APN 8 73,199,043 (GRCm39) missense probably benign 0.01
IGL03275:1700030K09Rik APN 8 73,198,968 (GRCm39) missense probably damaging 1.00
R0417:1700030K09Rik UTSW 8 73,199,244 (GRCm39) missense probably damaging 0.97
R0501:1700030K09Rik UTSW 8 73,209,216 (GRCm39) missense probably benign 0.01
R1444:1700030K09Rik UTSW 8 73,205,230 (GRCm39) missense probably damaging 1.00
R1556:1700030K09Rik UTSW 8 73,203,477 (GRCm39) missense probably damaging 1.00
R2153:1700030K09Rik UTSW 8 73,208,959 (GRCm39) missense probably benign 0.01
R2154:1700030K09Rik UTSW 8 73,208,959 (GRCm39) missense probably benign 0.01
R3743:1700030K09Rik UTSW 8 73,199,013 (GRCm39) missense probably benign 0.41
R4787:1700030K09Rik UTSW 8 73,199,008 (GRCm39) nonsense probably null
R4860:1700030K09Rik UTSW 8 73,209,267 (GRCm39) missense possibly damaging 0.87
R4860:1700030K09Rik UTSW 8 73,209,267 (GRCm39) missense possibly damaging 0.87
R4994:1700030K09Rik UTSW 8 73,208,962 (GRCm39) missense probably benign 0.02
R5857:1700030K09Rik UTSW 8 73,203,369 (GRCm39) missense probably benign 0.04
R6256:1700030K09Rik UTSW 8 73,205,272 (GRCm39) missense probably damaging 1.00
R7129:1700030K09Rik UTSW 8 73,209,199 (GRCm39) missense probably damaging 1.00
R7366:1700030K09Rik UTSW 8 73,203,303 (GRCm39) missense possibly damaging 0.65
R7923:1700030K09Rik UTSW 8 73,198,755 (GRCm39) missense probably damaging 1.00
R8322:1700030K09Rik UTSW 8 73,199,219 (GRCm39) missense probably benign 0.32
R9109:1700030K09Rik UTSW 8 73,198,923 (GRCm39) missense probably benign 0.01
R9298:1700030K09Rik UTSW 8 73,198,923 (GRCm39) missense probably benign 0.01
R9409:1700030K09Rik UTSW 8 73,211,888 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATCACCTACTCGACTGGAAGC -3'
(R):5'- TTACCCTTGCTCCACTGGTAGG -3'

Sequencing Primer
(F):5'- CAGATGTGGCCCAAGAATTGTGTG -3'
(R):5'- TTGCTCCACTGGTAGGCAAAG -3'
Posted On 2014-10-30