Incidental Mutation 'R2298:Tenm2'
ID 245233
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Name teneurin transmembrane protein 2
Synonyms D3Bwg1534e, Odz2, 9330187F13Rik, Ten-m2, 2610040L17Rik
MMRRC Submission 040297-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.569) question?
Stock # R2298 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 35897483-37126791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35937604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1690 (T1690A)
Ref Sequence ENSEMBL: ENSMUSP00000129951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000057207
AA Change: T1691A

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: T1691A

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102801
AA Change: T1690A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: T1690A

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163524
AA Change: T1690A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: T1690A

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,209,247 (GRCm39) D459G probably benign Het
Abhd12 C A 2: 150,743,414 (GRCm39) probably benign Het
Atcay A T 10: 81,046,397 (GRCm39) I309N probably damaging Het
Capn8 T C 1: 182,440,985 (GRCm39) V473A probably benign Het
Cramp1 T C 17: 25,216,454 (GRCm39) I220V probably damaging Het
Creb3l1 G A 2: 91,822,321 (GRCm39) P222S probably damaging Het
Crocc G A 4: 140,752,770 (GRCm39) A1374V probably benign Het
Crybg1 A G 10: 43,875,218 (GRCm39) L630S probably damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Erbb4 C T 1: 68,081,690 (GRCm39) D1115N probably damaging Het
Fasn T A 11: 120,704,642 (GRCm39) L1314F possibly damaging Het
Galm T A 17: 80,489,126 (GRCm39) C84* probably null Het
H3f3a C T 1: 180,630,703 (GRCm39) R117H probably benign Het
Klf13 T C 7: 63,541,504 (GRCm39) K208E probably damaging Het
Kremen1 AGGCGG AGGCGGCGG 11: 5,151,788 (GRCm39) probably benign Het
Lgmn A G 12: 102,361,937 (GRCm39) F388S probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Msh2 T A 17: 88,015,930 (GRCm39) Y521N probably damaging Het
Myo5b G T 18: 74,758,676 (GRCm39) R219L probably damaging Het
Myzap A T 9: 71,456,039 (GRCm39) M327K probably damaging Het
Ngfr AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 95,478,316 (GRCm39) probably benign Het
Phf8-ps T C 17: 33,285,752 (GRCm39) E350G probably damaging Het
Rps6ka5 A G 12: 100,517,713 (GRCm39) F796S probably damaging Het
Srl T C 16: 4,300,762 (GRCm39) I332V probably damaging Het
Stab2 T A 10: 86,790,338 (GRCm39) probably null Het
Traf4 T A 11: 78,051,677 (GRCm39) D241V probably benign Het
Trpv6 A G 6: 41,613,010 (GRCm39) I52T possibly damaging Het
Zfp768 T A 7: 126,943,361 (GRCm39) M256L probably benign Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36,097,726 (GRCm39) splice site probably benign
IGL00834:Tenm2 APN 11 35,915,085 (GRCm39) missense probably damaging 1.00
IGL00911:Tenm2 APN 11 35,899,560 (GRCm39) nonsense probably null
IGL00937:Tenm2 APN 11 35,915,450 (GRCm39) missense probably damaging 1.00
IGL01154:Tenm2 APN 11 35,932,371 (GRCm39) missense probably damaging 1.00
IGL01313:Tenm2 APN 11 35,915,075 (GRCm39) missense probably damaging 0.98
IGL01346:Tenm2 APN 11 35,918,232 (GRCm39) nonsense probably null
IGL01539:Tenm2 APN 11 35,997,654 (GRCm39) missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36,755,711 (GRCm39) missense probably damaging 0.98
IGL01780:Tenm2 APN 11 35,937,768 (GRCm39) missense probably benign
IGL01821:Tenm2 APN 11 35,914,710 (GRCm39) missense probably damaging 0.98
IGL01988:Tenm2 APN 11 35,918,078 (GRCm39) missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36,097,922 (GRCm39) missense probably benign
IGL02449:Tenm2 APN 11 35,914,449 (GRCm39) missense probably damaging 0.99
IGL02505:Tenm2 APN 11 35,942,743 (GRCm39) nonsense probably null
IGL02649:Tenm2 APN 11 36,097,912 (GRCm39) missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 35,959,285 (GRCm39) missense probably benign 0.05
IGL02801:Tenm2 APN 11 35,937,857 (GRCm39) nonsense probably null
IGL02928:Tenm2 APN 11 35,917,997 (GRCm39) missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 35,932,471 (GRCm39) missense probably damaging 1.00
IGL03202:Tenm2 APN 11 35,915,375 (GRCm39) missense probably damaging 1.00
IGL03213:Tenm2 APN 11 35,914,157 (GRCm39) missense probably benign 0.05
IGL03276:Tenm2 APN 11 35,963,603 (GRCm39) missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 35,942,852 (GRCm39) splice site probably null
IGL03381:Tenm2 APN 11 35,959,238 (GRCm39) missense probably benign 0.01
IGL03398:Tenm2 APN 11 35,915,370 (GRCm39) missense probably damaging 1.00
browser UTSW 11 35,937,592 (GRCm39) critical splice donor site probably null
mosaic UTSW 11 35,954,602 (GRCm39) critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36,164,235 (GRCm39) missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36,054,557 (GRCm39) missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 35,954,729 (GRCm39) missense probably damaging 0.99
R0004:Tenm2 UTSW 11 35,914,184 (GRCm39) missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36,097,951 (GRCm39) splice site probably benign
R0537:Tenm2 UTSW 11 36,054,557 (GRCm39) missense probably damaging 1.00
R0599:Tenm2 UTSW 11 35,915,607 (GRCm39) missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36,834,803 (GRCm39) missense probably damaging 1.00
R0693:Tenm2 UTSW 11 35,915,636 (GRCm39) missense probably damaging 1.00
R0991:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36,755,511 (GRCm39) missense probably benign 0.30
R1177:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 35,899,185 (GRCm39) missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 35,932,486 (GRCm39) missense probably damaging 1.00
R1272:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 35,959,421 (GRCm39) splice site probably benign
R1374:Tenm2 UTSW 11 35,899,281 (GRCm39) missense probably benign 0.00
R1542:Tenm2 UTSW 11 36,191,047 (GRCm39) missense probably damaging 0.99
R1573:Tenm2 UTSW 11 35,937,896 (GRCm39) missense probably damaging 1.00
R1579:Tenm2 UTSW 11 35,997,610 (GRCm39) missense probably damaging 1.00
R1697:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 35,898,930 (GRCm39) missense probably damaging 1.00
R1756:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 35,914,209 (GRCm39) missense probably damaging 0.99
R1950:Tenm2 UTSW 11 35,954,004 (GRCm39) missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 35,938,374 (GRCm39) missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 35,938,091 (GRCm39) nonsense probably null
R2117:Tenm2 UTSW 11 35,915,681 (GRCm39) missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36,755,689 (GRCm39) missense probably damaging 0.98
R2432:Tenm2 UTSW 11 35,918,018 (GRCm39) missense probably damaging 1.00
R3014:Tenm2 UTSW 11 35,914,800 (GRCm39) missense probably damaging 1.00
R3115:Tenm2 UTSW 11 35,914,193 (GRCm39) missense probably damaging 1.00
R3684:Tenm2 UTSW 11 35,942,644 (GRCm39) missense probably benign 0.00
R3685:Tenm2 UTSW 11 35,942,644 (GRCm39) missense probably benign 0.00
R3705:Tenm2 UTSW 11 35,959,153 (GRCm39) missense probably damaging 0.97
R3820:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3821:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3822:Tenm2 UTSW 11 35,915,147 (GRCm39) missense probably damaging 0.98
R3844:Tenm2 UTSW 11 35,938,365 (GRCm39) missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36,030,401 (GRCm39) critical splice donor site probably null
R4019:Tenm2 UTSW 11 35,937,901 (GRCm39) missense probably benign 0.04
R4062:Tenm2 UTSW 11 35,899,482 (GRCm39) missense probably damaging 1.00
R4367:Tenm2 UTSW 11 35,918,225 (GRCm39) missense probably benign
R4395:Tenm2 UTSW 11 35,915,451 (GRCm39) missense probably benign 0.23
R4508:Tenm2 UTSW 11 35,899,172 (GRCm39) missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 35,953,931 (GRCm39) missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 35,937,607 (GRCm39) missense probably damaging 1.00
R4644:Tenm2 UTSW 11 35,937,963 (GRCm39) missense probably benign 0.00
R4661:Tenm2 UTSW 11 35,915,275 (GRCm39) missense probably damaging 0.99
R4669:Tenm2 UTSW 11 35,901,314 (GRCm39) missense probably damaging 1.00
R4687:Tenm2 UTSW 11 35,939,924 (GRCm39) missense probably benign
R4711:Tenm2 UTSW 11 36,191,039 (GRCm39) missense probably damaging 0.98
R4816:Tenm2 UTSW 11 35,918,117 (GRCm39) missense probably damaging 1.00
R4843:Tenm2 UTSW 11 35,914,847 (GRCm39) missense probably damaging 1.00
R4850:Tenm2 UTSW 11 35,914,315 (GRCm39) nonsense probably null
R4870:Tenm2 UTSW 11 35,969,396 (GRCm39) missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36,097,907 (GRCm39) missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5073:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5074:Tenm2 UTSW 11 35,959,208 (GRCm39) missense probably damaging 0.99
R5081:Tenm2 UTSW 11 35,915,460 (GRCm39) missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36,834,989 (GRCm39) missense probably damaging 1.00
R5170:Tenm2 UTSW 11 35,915,633 (GRCm39) missense probably damaging 0.98
R5253:Tenm2 UTSW 11 35,938,028 (GRCm39) nonsense probably null
R5343:Tenm2 UTSW 11 35,960,330 (GRCm39) missense probably benign 0.00
R5493:Tenm2 UTSW 11 36,755,503 (GRCm39) missense probably benign 0.01
R5600:Tenm2 UTSW 11 36,054,541 (GRCm39) splice site probably null
R5677:Tenm2 UTSW 11 36,032,510 (GRCm39) missense probably damaging 0.98
R5703:Tenm2 UTSW 11 35,914,626 (GRCm39) missense probably benign 0.34
R5707:Tenm2 UTSW 11 35,938,009 (GRCm39) missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 35,963,556 (GRCm39) critical splice donor site probably null
R6063:Tenm2 UTSW 11 36,054,544 (GRCm39) critical splice donor site probably null
R6086:Tenm2 UTSW 11 35,899,473 (GRCm39) missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 35,899,610 (GRCm39) missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36,030,517 (GRCm39) missense probably damaging 0.99
R6193:Tenm2 UTSW 11 35,937,621 (GRCm39) missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36,755,686 (GRCm39) missense probably benign 0.44
R6477:Tenm2 UTSW 11 35,901,334 (GRCm39) critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 35,954,602 (GRCm39) critical splice donor site probably null
R6668:Tenm2 UTSW 11 35,937,592 (GRCm39) critical splice donor site probably null
R6825:Tenm2 UTSW 11 35,937,711 (GRCm39) missense probably benign 0.02
R6885:Tenm2 UTSW 11 35,914,407 (GRCm39) missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36,062,236 (GRCm39) missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36,054,644 (GRCm39) missense probably damaging 0.99
R7153:Tenm2 UTSW 11 35,915,009 (GRCm39) missense probably damaging 0.98
R7173:Tenm2 UTSW 11 35,932,378 (GRCm39) missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36,062,263 (GRCm39) missense probably damaging 1.00
R7205:Tenm2 UTSW 11 35,939,956 (GRCm39) missense probably damaging 0.99
R7250:Tenm2 UTSW 11 35,963,625 (GRCm39) missense probably damaging 1.00
R7290:Tenm2 UTSW 11 35,914,298 (GRCm39) missense probably damaging 1.00
R7366:Tenm2 UTSW 11 35,960,241 (GRCm39) missense probably benign 0.09
R7432:Tenm2 UTSW 11 36,755,768 (GRCm39) missense probably benign
R7504:Tenm2 UTSW 11 36,030,570 (GRCm39) missense probably damaging 1.00
R7513:Tenm2 UTSW 11 35,942,727 (GRCm39) missense probably benign 0.34
R7523:Tenm2 UTSW 11 35,969,408 (GRCm39) splice site probably null
R7527:Tenm2 UTSW 11 36,097,803 (GRCm39) missense probably damaging 1.00
R7648:Tenm2 UTSW 11 35,997,563 (GRCm39) missense probably damaging 1.00
R7653:Tenm2 UTSW 11 35,938,174 (GRCm39) missense probably benign 0.09
R7717:Tenm2 UTSW 11 36,755,762 (GRCm39) missense probably damaging 0.97
R7739:Tenm2 UTSW 11 35,960,388 (GRCm39) missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 35,914,133 (GRCm39) missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 35,901,276 (GRCm39) missense probably damaging 0.99
R7803:Tenm2 UTSW 11 35,937,943 (GRCm39) missense probably damaging 0.98
R7834:Tenm2 UTSW 11 35,915,681 (GRCm39) missense probably damaging 1.00
R7838:Tenm2 UTSW 11 35,997,626 (GRCm39) missense probably benign 0.02
R8073:Tenm2 UTSW 11 36,030,471 (GRCm39) missense possibly damaging 0.56
R8076:Tenm2 UTSW 11 35,918,048 (GRCm39) missense probably benign 0.23
R8109:Tenm2 UTSW 11 35,899,137 (GRCm39) missense probably benign
R8306:Tenm2 UTSW 11 35,960,196 (GRCm39) missense possibly damaging 0.52
R8352:Tenm2 UTSW 11 35,914,428 (GRCm39) missense probably damaging 0.98
R8452:Tenm2 UTSW 11 35,914,428 (GRCm39) missense probably damaging 0.98
R8864:Tenm2 UTSW 11 35,918,022 (GRCm39) missense possibly damaging 0.95
R8880:Tenm2 UTSW 11 35,942,788 (GRCm39) missense probably damaging 0.99
R8943:Tenm2 UTSW 11 36,834,861 (GRCm39) missense probably damaging 0.98
R8969:Tenm2 UTSW 11 35,942,688 (GRCm39) missense probably damaging 0.99
R9168:Tenm2 UTSW 11 35,930,722 (GRCm39) missense probably damaging 1.00
R9279:Tenm2 UTSW 11 35,959,303 (GRCm39) missense probably benign 0.00
R9294:Tenm2 UTSW 11 35,915,327 (GRCm39) missense probably damaging 0.98
R9320:Tenm2 UTSW 11 35,914,474 (GRCm39) missense probably damaging 0.99
R9373:Tenm2 UTSW 11 35,930,713 (GRCm39) missense probably damaging 1.00
R9408:Tenm2 UTSW 11 35,960,246 (GRCm39) missense probably damaging 1.00
R9410:Tenm2 UTSW 11 36,032,396 (GRCm39) missense probably damaging 0.99
R9454:Tenm2 UTSW 11 36,112,286 (GRCm39) missense probably benign
R9489:Tenm2 UTSW 11 36,834,791 (GRCm39) missense probably damaging 0.99
R9711:Tenm2 UTSW 11 35,915,341 (GRCm39) missense probably damaging 0.99
RF021:Tenm2 UTSW 11 35,915,030 (GRCm39) missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 35,915,027 (GRCm39) missense probably damaging 1.00
X0063:Tenm2 UTSW 11 35,915,557 (GRCm39) missense probably benign
Z1088:Tenm2 UTSW 11 36,164,094 (GRCm39) missense probably damaging 1.00
Z1177:Tenm2 UTSW 11 36,191,162 (GRCm39) missense probably damaging 0.98
Z1177:Tenm2 UTSW 11 35,899,061 (GRCm39) missense possibly damaging 0.95
Z1177:Tenm2 UTSW 11 36,275,957 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATATCAGAGGCCCGACAGAG -3'
(R):5'- GGAATTCCCTAAAGATCCGCCG -3'

Sequencing Primer
(F):5'- CCGACAGAGCAAATCATTTAGGAGTC -3'
(R):5'- CGGGACAGCAGTGGCATG -3'
Posted On 2014-10-30