Incidental Mutation 'R0279:Ttbk2'
ID24524
Institutional Source Beutler Lab
Gene Symbol Ttbk2
Ensembl Gene ENSMUSG00000090100
Gene Nametau tubulin kinase 2
SynonymsB930008N24Rik, 2610507N02Rik, TTK
MMRRC Submission 038501-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0279 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120732816-120850604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120748960 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 491 (H491Q)
Ref Sequence ENSEMBL: ENSMUSP00000083001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000131389] [ENSMUST00000143051]
Predicted Effect probably benign
Transcript: ENSMUST00000028740
AA Change: H560Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100
AA Change: H560Q

DomainStartEndE-ValueType
Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057135
AA Change: H491Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100
AA Change: H491Q

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085840
AA Change: H491Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100
AA Change: H491Q

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131389
SMART Domains Protein: ENSMUSP00000118905
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 145 1.3e-18 PFAM
Pfam:Pkinase_Tyr 21 148 9.7e-12 PFAM
Pfam:Pkinase 145 239 1.2e-5 PFAM
low complexity region 265 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143051
AA Change: H491Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121996
Gene: ENSMUSG00000090100
AA Change: H491Q

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 2.4e-32 PFAM
Pfam:Pkinase_Tyr 21 280 7.7e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148285
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit complete preweaning lethality, decreased embryo size, growth retardation, and incomplete turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610528J11Rik A T 4: 118,529,293 M1L probably benign Het
5730596B20Rik T A 6: 52,179,202 probably benign Het
Acrbp T C 6: 125,053,954 probably null Het
Acss3 A G 10: 107,084,871 I126T possibly damaging Het
Aff3 T C 1: 38,535,569 E110G probably damaging Het
Aldh1a3 T C 7: 66,409,252 I113V probably benign Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Atp2b4 A G 1: 133,729,702 probably benign Het
Atp8a1 C T 5: 67,813,092 probably null Het
Bhmt A G 13: 93,625,464 C104R probably damaging Het
Ccdc151 A G 9: 21,990,247 probably benign Het
Cct5 T G 15: 31,591,031 E508A probably damaging Het
Celsr1 T A 15: 85,902,864 E2761D probably benign Het
Clstn1 T C 4: 149,643,674 S600P probably damaging Het
Cnppd1 A G 1: 75,136,929 S232P probably damaging Het
Crybb3 T C 5: 113,079,753 probably null Het
Csmd1 A G 8: 16,223,235 I861T probably damaging Het
Cyp2d10 A C 15: 82,405,339 S191A possibly damaging Het
Ddx10 T C 9: 53,235,304 D206G probably damaging Het
Dnah1 G T 14: 31,302,375 H916N possibly damaging Het
Dnah9 A G 11: 65,911,789 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Etnppl A G 3: 130,629,413 R248G probably damaging Het
Eya3 T C 4: 132,719,247 F369L probably damaging Het
Fam129a T C 1: 151,709,206 probably null Het
Fam170b T C 14: 32,834,068 probably benign Het
Fli1 A T 9: 32,461,427 V105D probably damaging Het
Fmo1 T C 1: 162,830,272 I433M possibly damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Foxe3 T C 4: 114,925,568 D149G probably damaging Het
Gk5 T C 9: 96,174,804 probably benign Het
Gm14226 A G 2: 155,025,452 D443G possibly damaging Het
Gm9796 C T 11: 95,697,995 noncoding transcript Het
Golga4 A T 9: 118,568,993 R52S probably benign Het
Hey2 C A 10: 30,834,010 C249F probably damaging Het
Ipo9 A T 1: 135,420,363 probably benign Het
Ireb2 C A 9: 54,886,593 T269K probably benign Het
Kansl3 A G 1: 36,351,969 V274A probably damaging Het
Kcnk2 C T 1: 189,209,972 A352T possibly damaging Het
Lamc2 T C 1: 153,130,696 E903G probably benign Het
Lepr A G 4: 101,750,344 K253R probably benign Het
Lmntd2 T C 7: 141,213,623 probably benign Het
Lrrc39 A T 3: 116,578,303 T240S probably benign Het
Lrrc43 A G 5: 123,497,022 probably null Het
Maf T C 8: 115,705,756 M370V possibly damaging Het
Mib2 G A 4: 155,661,216 S46L possibly damaging Het
Mms22l C T 4: 24,497,867 T63I probably damaging Het
Morc2a T A 11: 3,683,989 S700R probably benign Het
Mpz A G 1: 171,159,929 probably benign Het
Ncam2 T C 16: 81,623,337 probably benign Het
Nudt14 C T 12: 112,938,417 A123T probably damaging Het
Olfr1016 A T 2: 85,799,535 I245N possibly damaging Het
Olfr13 G A 6: 43,174,758 M257I probably benign Het
Olfr239 C T 17: 33,199,324 T92I probably benign Het
Otoa T C 7: 121,111,079 probably benign Het
Pik3cg G A 12: 32,204,791 T399I probably damaging Het
Pkn3 C T 2: 30,083,297 A377V probably benign Het
Ppan A G 9: 20,891,529 N327S probably benign Het
Prkca T C 11: 108,054,111 probably benign Het
Prrc2c A T 1: 162,715,464 V320E probably damaging Het
Ptprq A G 10: 107,608,417 V1442A probably damaging Het
Rapgef1 C T 2: 29,726,227 R834C probably damaging Het
Rbms1 G T 2: 60,842,410 N44K probably damaging Het
Rfwd3 A C 8: 111,282,733 F404V probably benign Het
Rimbp3 G T 16: 17,209,453 R247L probably benign Het
Serpinb1b T C 13: 33,093,713 S310P possibly damaging Het
Smtn C A 11: 3,530,235 V329L probably damaging Het
Snapc2 T C 8: 4,254,979 probably benign Het
Spam1 A T 6: 24,800,419 M386L probably benign Het
Syne2 A G 12: 76,095,613 E6208G probably damaging Het
Teddm1a T C 1: 153,892,623 Y278H probably damaging Het
Tnfaip6 A T 2: 52,055,916 N258I possibly damaging Het
Trpm4 C T 7: 45,322,048 R188Q probably damaging Het
Urgcp C T 11: 5,716,989 E450K probably benign Het
Vmn1r228 T C 17: 20,776,375 N294D probably benign Het
Wdfy3 A T 5: 101,868,092 C2606S probably damaging Het
Wdr33 T A 18: 31,888,324 H642Q unknown Het
Zbtb46 A G 2: 181,411,774 S382P possibly damaging Het
Zfp217 A G 2: 170,119,780 I209T probably benign Het
Zranb3 T A 1: 127,963,773 N822I probably benign Het
Other mutations in Ttbk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ttbk2 APN 2 120748833 nonsense probably null
IGL00484:Ttbk2 APN 2 120773886 nonsense probably null
IGL00767:Ttbk2 APN 2 120745745 missense probably benign
IGL00809:Ttbk2 APN 2 120760269 missense probably damaging 1.00
IGL01484:Ttbk2 APN 2 120739833 missense possibly damaging 0.95
IGL01974:Ttbk2 APN 2 120786083 missense probably damaging 1.00
IGL02488:Ttbk2 APN 2 120755871 missense probably benign 0.00
IGL02874:Ttbk2 APN 2 120745712 missense probably damaging 0.99
IGL02893:Ttbk2 APN 2 120783729 missense probably damaging 1.00
IGL03210:Ttbk2 APN 2 120822492 missense probably damaging 0.99
R0362:Ttbk2 UTSW 2 120745783 missense possibly damaging 0.90
R0376:Ttbk2 UTSW 2 120777581 missense probably damaging 1.00
R0400:Ttbk2 UTSW 2 120750242 missense probably benign 0.02
R0601:Ttbk2 UTSW 2 120825296 missense possibly damaging 0.73
R0606:Ttbk2 UTSW 2 120773872 missense probably damaging 1.00
R0664:Ttbk2 UTSW 2 120748821 missense probably damaging 0.99
R0718:Ttbk2 UTSW 2 120745160 missense probably benign 0.00
R0718:Ttbk2 UTSW 2 120748575 missense probably benign 0.01
R0783:Ttbk2 UTSW 2 120739977 missense possibly damaging 0.74
R0906:Ttbk2 UTSW 2 120783781 missense probably damaging 1.00
R1141:Ttbk2 UTSW 2 120806851 missense probably damaging 1.00
R1363:Ttbk2 UTSW 2 120806908 critical splice acceptor site probably null
R1420:Ttbk2 UTSW 2 120745912 missense probably benign 0.00
R1734:Ttbk2 UTSW 2 120755838 missense probably benign 0.01
R2033:Ttbk2 UTSW 2 120806849 missense probably damaging 0.98
R2047:Ttbk2 UTSW 2 120748916 missense probably damaging 0.99
R2893:Ttbk2 UTSW 2 120745610 unclassified probably null
R3783:Ttbk2 UTSW 2 120773815 splice site probably benign
R3785:Ttbk2 UTSW 2 120773815 splice site probably benign
R3870:Ttbk2 UTSW 2 120740019 missense probably damaging 1.00
R4024:Ttbk2 UTSW 2 120760255 missense possibly damaging 0.91
R4039:Ttbk2 UTSW 2 120745795 missense probably benign 0.01
R4060:Ttbk2 UTSW 2 120748984 missense probably benign 0.26
R4624:Ttbk2 UTSW 2 120773323 missense probably benign 0.19
R4634:Ttbk2 UTSW 2 120740192 missense probably damaging 1.00
R4708:Ttbk2 UTSW 2 120739861 missense probably damaging 1.00
R4727:Ttbk2 UTSW 2 120745370 missense probably benign 0.01
R4811:Ttbk2 UTSW 2 120740070 missense possibly damaging 0.62
R4962:Ttbk2 UTSW 2 120745150 missense probably damaging 1.00
R4964:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R4966:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R5369:Ttbk2 UTSW 2 120825262 start gained probably benign
R5430:Ttbk2 UTSW 2 120777565 missense probably damaging 1.00
R5607:Ttbk2 UTSW 2 120806824 missense possibly damaging 0.89
R5812:Ttbk2 UTSW 2 120822559 missense probably damaging 0.99
R5898:Ttbk2 UTSW 2 120745040 missense probably benign 0.08
R5951:Ttbk2 UTSW 2 120773283 missense probably benign 0.02
R6135:Ttbk2 UTSW 2 120750317 missense probably damaging 1.00
R6889:Ttbk2 UTSW 2 120773353 missense probably damaging 1.00
R6907:Ttbk2 UTSW 2 120825270 missense probably benign 0.00
R7013:Ttbk2 UTSW 2 120745784 missense possibly damaging 0.89
R7128:Ttbk2 UTSW 2 120746088 missense probably benign 0.00
R7173:Ttbk2 UTSW 2 120740111 missense probably damaging 1.00
R7358:Ttbk2 UTSW 2 120790310 missense probably damaging 1.00
R7475:Ttbk2 UTSW 2 120748640 missense probably benign 0.01
R7891:Ttbk2 UTSW 2 120786029 missense probably damaging 1.00
R7974:Ttbk2 UTSW 2 120786029 missense probably damaging 1.00
RF010:Ttbk2 UTSW 2 120790339 nonsense probably null
RF021:Ttbk2 UTSW 2 120748634 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATCCCTCAAGGACCTGAAGCAC -3'
(R):5'- CAAGTAGAGAGCATCATGGCCCTG -3'

Sequencing Primer
(F):5'- TTGTCCTAAAGTCCTGAAGGTC -3'
(R):5'- ATCATGGCCCTGTGAGACTC -3'
Posted On2013-04-16