Incidental Mutation 'R2298:Cramp1'
ID 245242
Institutional Source Beutler Lab
Gene Symbol Cramp1
Ensembl Gene ENSMUSG00000038002
Gene Name cramped chromatin regulator 1
Synonyms 5830477H08Rik, Tce4, Cramp1l
MMRRC Submission 040297-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2298 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 25180200-25234762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25216454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 220 (I220V)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
AlphaFold Q6PG95
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: I220V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: I220V

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,209,247 (GRCm39) D459G probably benign Het
Abhd12 C A 2: 150,743,414 (GRCm39) probably benign Het
Atcay A T 10: 81,046,397 (GRCm39) I309N probably damaging Het
Capn8 T C 1: 182,440,985 (GRCm39) V473A probably benign Het
Creb3l1 G A 2: 91,822,321 (GRCm39) P222S probably damaging Het
Crocc G A 4: 140,752,770 (GRCm39) A1374V probably benign Het
Crybg1 A G 10: 43,875,218 (GRCm39) L630S probably damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Erbb4 C T 1: 68,081,690 (GRCm39) D1115N probably damaging Het
Fasn T A 11: 120,704,642 (GRCm39) L1314F possibly damaging Het
Galm T A 17: 80,489,126 (GRCm39) C84* probably null Het
H3f3a C T 1: 180,630,703 (GRCm39) R117H probably benign Het
Klf13 T C 7: 63,541,504 (GRCm39) K208E probably damaging Het
Kremen1 AGGCGG AGGCGGCGG 11: 5,151,788 (GRCm39) probably benign Het
Lgmn A G 12: 102,361,937 (GRCm39) F388S probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Msh2 T A 17: 88,015,930 (GRCm39) Y521N probably damaging Het
Myo5b G T 18: 74,758,676 (GRCm39) R219L probably damaging Het
Myzap A T 9: 71,456,039 (GRCm39) M327K probably damaging Het
Ngfr AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 95,478,316 (GRCm39) probably benign Het
Phf8-ps T C 17: 33,285,752 (GRCm39) E350G probably damaging Het
Rps6ka5 A G 12: 100,517,713 (GRCm39) F796S probably damaging Het
Srl T C 16: 4,300,762 (GRCm39) I332V probably damaging Het
Stab2 T A 10: 86,790,338 (GRCm39) probably null Het
Tenm2 T C 11: 35,937,604 (GRCm39) T1690A possibly damaging Het
Traf4 T A 11: 78,051,677 (GRCm39) D241V probably benign Het
Trpv6 A G 6: 41,613,010 (GRCm39) I52T possibly damaging Het
Zfp768 T A 7: 126,943,361 (GRCm39) M256L probably benign Het
Other mutations in Cramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1 APN 17 25,202,925 (GRCm39) missense probably benign 0.11
IGL01360:Cramp1 APN 17 25,216,547 (GRCm39) missense probably damaging 1.00
IGL01966:Cramp1 APN 17 25,201,917 (GRCm39) missense probably benign 0.01
IGL02211:Cramp1 APN 17 25,196,610 (GRCm39) missense possibly damaging 0.94
IGL02474:Cramp1 APN 17 25,204,024 (GRCm39) missense probably damaging 0.98
IGL02798:Cramp1 APN 17 25,187,894 (GRCm39) splice site probably benign
IGL03340:Cramp1 APN 17 25,192,516 (GRCm39) missense probably damaging 1.00
Interred UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R0106:Cramp1 UTSW 17 25,191,350 (GRCm39) missense probably benign 0.30
R1054:Cramp1 UTSW 17 25,202,151 (GRCm39) missense probably damaging 1.00
R1220:Cramp1 UTSW 17 25,201,211 (GRCm39) missense probably damaging 1.00
R1341:Cramp1 UTSW 17 25,196,514 (GRCm39) missense probably damaging 1.00
R1491:Cramp1 UTSW 17 25,191,323 (GRCm39) missense probably benign 0.17
R1610:Cramp1 UTSW 17 25,202,925 (GRCm39) missense probably benign 0.11
R1649:Cramp1 UTSW 17 25,202,217 (GRCm39) missense probably damaging 1.00
R1795:Cramp1 UTSW 17 25,183,884 (GRCm39) missense probably damaging 1.00
R1856:Cramp1 UTSW 17 25,187,952 (GRCm39) missense probably damaging 1.00
R1881:Cramp1 UTSW 17 25,196,656 (GRCm39) splice site probably benign
R1968:Cramp1 UTSW 17 25,183,913 (GRCm39) missense probably damaging 1.00
R2047:Cramp1 UTSW 17 25,222,189 (GRCm39) nonsense probably null
R2099:Cramp1 UTSW 17 25,192,059 (GRCm39) missense probably benign 0.01
R3752:Cramp1 UTSW 17 25,190,532 (GRCm39) missense probably damaging 1.00
R3821:Cramp1 UTSW 17 25,193,756 (GRCm39) missense probably damaging 1.00
R3861:Cramp1 UTSW 17 25,216,588 (GRCm39) splice site probably benign
R4399:Cramp1 UTSW 17 25,198,559 (GRCm39) missense probably damaging 1.00
R4847:Cramp1 UTSW 17 25,204,063 (GRCm39) missense probably damaging 1.00
R4883:Cramp1 UTSW 17 25,201,293 (GRCm39) missense probably benign
R5579:Cramp1 UTSW 17 25,192,087 (GRCm39) missense possibly damaging 0.89
R5631:Cramp1 UTSW 17 25,204,577 (GRCm39) missense possibly damaging 0.93
R5716:Cramp1 UTSW 17 25,193,709 (GRCm39) missense probably damaging 0.99
R6589:Cramp1 UTSW 17 25,196,466 (GRCm39) splice site probably null
R6631:Cramp1 UTSW 17 25,202,931 (GRCm39) missense probably benign 0.40
R7307:Cramp1 UTSW 17 25,193,719 (GRCm39) missense possibly damaging 0.94
R7323:Cramp1 UTSW 17 25,201,379 (GRCm39) missense possibly damaging 0.90
R7672:Cramp1 UTSW 17 25,201,440 (GRCm39) missense probably damaging 0.96
R7832:Cramp1 UTSW 17 25,202,196 (GRCm39) missense probably damaging 0.96
R8071:Cramp1 UTSW 17 25,201,674 (GRCm39) missense probably damaging 0.99
R8244:Cramp1 UTSW 17 25,190,384 (GRCm39) missense probably damaging 1.00
R8430:Cramp1 UTSW 17 25,196,536 (GRCm39) missense probably damaging 1.00
R8783:Cramp1 UTSW 17 25,193,732 (GRCm39) missense probably damaging 0.99
R8890:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8892:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8894:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8937:Cramp1 UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R8941:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R9029:Cramp1 UTSW 17 25,232,884 (GRCm39) missense probably damaging 1.00
R9047:Cramp1 UTSW 17 25,198,603 (GRCm39) missense possibly damaging 0.90
R9149:Cramp1 UTSW 17 25,187,920 (GRCm39) missense probably damaging 0.99
R9262:Cramp1 UTSW 17 25,232,920 (GRCm39) missense probably damaging 0.99
R9460:Cramp1 UTSW 17 25,222,281 (GRCm39) missense probably damaging 1.00
R9614:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9615:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9651:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9652:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9653:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9665:Cramp1 UTSW 17 25,196,545 (GRCm39) missense probably damaging 1.00
R9753:Cramp1 UTSW 17 25,191,320 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AATAGGTTCTGGACATGCCCC -3'
(R):5'- GTCCCATTTTGACTTTGATGATGC -3'

Sequencing Primer
(F):5'- TTCTGGACATGCCCCCAAGC -3'
(R):5'- GACTTTGAAGCCATTCAGAAC -3'
Posted On 2014-10-30