Incidental Mutation 'R2299:Vcpip1'
ID245247
Institutional Source Beutler Lab
Gene Symbol Vcpip1
Ensembl Gene ENSMUSG00000045210
Gene Namevalosin containing protein (p97)/p47 complex interacting protein 1
Synonyms5730421J18Rik, Vcip135, 5730538E15Rik
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location9718622-9748382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9745719 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 813 (L813S)
Ref Sequence ENSEMBL: ENSMUSP00000051248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057438]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057438
AA Change: L813S

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051248
Gene: ENSMUSG00000045210
AA Change: L813S

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 19 36 N/A INTRINSIC
Pfam:OTU 213 354 3.3e-15 PFAM
low complexity region 754 772 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209020
Meta Mutation Damage Score 0.1030 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a deubiquitinating enzyme that interacts with valosin containing protein p97 and plays a role in the assembly of Golgi apparatus during mitosis. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Vcpip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Vcpip1 APN 1 9724950 missense possibly damaging 0.75
IGL02888:Vcpip1 APN 1 9724786 missense probably damaging 0.98
IGL03246:Vcpip1 APN 1 9745957 missense probably benign 0.00
R0243:Vcpip1 UTSW 1 9747206 nonsense probably null
R0968:Vcpip1 UTSW 1 9746379 missense probably damaging 1.00
R1139:Vcpip1 UTSW 1 9746723 missense probably damaging 0.98
R1230:Vcpip1 UTSW 1 9725224 missense probably damaging 1.00
R1524:Vcpip1 UTSW 1 9724502 missense probably damaging 1.00
R1989:Vcpip1 UTSW 1 9745563 missense probably benign 0.11
R2135:Vcpip1 UTSW 1 9747810 missense probably benign 0.01
R4692:Vcpip1 UTSW 1 9748074 missense unknown
R4855:Vcpip1 UTSW 1 9747364 missense probably damaging 1.00
R4883:Vcpip1 UTSW 1 9747198 missense probably damaging 1.00
R4891:Vcpip1 UTSW 1 9748062 missense unknown
R4897:Vcpip1 UTSW 1 9747347 missense probably damaging 0.97
R5141:Vcpip1 UTSW 1 9748077 missense unknown
R5465:Vcpip1 UTSW 1 9747147 missense probably benign 0.16
R5651:Vcpip1 UTSW 1 9747840 missense probably damaging 0.99
R5664:Vcpip1 UTSW 1 9746379 missense probably damaging 0.99
R6131:Vcpip1 UTSW 1 9747292 missense probably damaging 0.99
R6187:Vcpip1 UTSW 1 9724780 missense probably damaging 1.00
R7042:Vcpip1 UTSW 1 9748153 missense unknown
R7268:Vcpip1 UTSW 1 9746082 missense probably damaging 0.99
R7417:Vcpip1 UTSW 1 9746315 missense probably benign 0.00
R7464:Vcpip1 UTSW 1 9746520 missense probably damaging 0.99
R8138:Vcpip1 UTSW 1 9748109 small deletion probably benign
R8350:Vcpip1 UTSW 1 9724606 missense probably benign
R8450:Vcpip1 UTSW 1 9724606 missense probably benign
Z1177:Vcpip1 UTSW 1 9747082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCAATCTCTTCTTGTTTCACAG -3'
(R):5'- CAGCCCAGAACTGTTTCTCC -3'

Sequencing Primer
(F):5'- AATCTCTTCTTGTTTCACAGTGTGG -3'
(R):5'- CAAGTACTATTCGTGATGGGCCATC -3'
Posted On2014-10-30