Mutagenetix > Incidental Mutation

Incidental Mutation 'R2299:Copa'

245251

Institutional Source

Beutler Lab

Gene Symbol

Copa

Ensembl Gene

ENSMUSG00000026553

Gene Name

coatomer protein complex subunit alpha

Synonyms

xenin

MMRRC Submission

040298-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R2299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

171910096-171949897 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 171949292 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1223 (I1223T)

Ref Sequence

ENSEMBL: ENSMUSP00000027833 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000135192]

AlphaFold

Q8CIE6

Predicted Effect

probably benign
Transcript: ENSMUST00000027833
AA Change: I1223T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: I1223T

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	776	5.4e-144	PFAM
Pfam:COPI_C	824	1233	1.4e-190	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122845

Predicted Effect

probably benign
Transcript: ENSMUST00000135192
AA Change: I1214T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: I1214T

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	767	1.1e-148	PFAM
Pfam:COPI_C	815	1224	3.6e-216	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142765

Meta Mutation Damage Score

0.1267

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	A	G	3: 89,971,845 (GRCm39)	N68S	possibly damaging	Het
5031439G07Rik	A	C	15: 84,837,486 (GRCm39)	F276V	possibly damaging	Het
Abca12	C	T	1: 71,297,381 (GRCm39)	V2370I	probably damaging	Het
Acsl3	T	G	1: 78,676,827 (GRCm39)	C469W	probably damaging	Het
Adgrg5	A	T	8: 95,665,204 (GRCm39)	I372F	possibly damaging	Het
Ankrd42	A	G	7: 92,239,462 (GRCm39)	I442T	probably benign	Het
Arsi	G	A	18: 61,049,723 (GRCm39)	G202E	probably benign	Het
Bmpr1b	C	A	3: 141,550,963 (GRCm39)	R376L	probably damaging	Het
C1qtnf6	T	A	15: 78,409,542 (GRCm39)	T102S	probably benign	Het
Chordc1	T	C	9: 18,213,404 (GRCm39)	L85P	probably damaging	Het
Clec2j	T	A	6: 128,632,199 (GRCm39)		noncoding transcript	Het
Crygs	C	T	16: 22,624,301 (GRCm39)	G102D	possibly damaging	Het
Cyfip2	T	A	11: 46,176,958 (GRCm39)	E74V	probably benign	Het
Dsg1a	A	T	18: 20,473,207 (GRCm39)	D760V	probably damaging	Het
Folr1	A	G	7: 101,513,199 (GRCm39)	L32P	probably damaging	Het
Galnt13	A	T	2: 54,950,595 (GRCm39)	R425S	possibly damaging	Het
Gm4559	A	T	7: 141,827,572 (GRCm39)	C177S	unknown	Het
H2bc9	A	G	13: 23,727,354 (GRCm39)	S57P	probably damaging	Het
H3f3a	C	T	1: 180,630,703 (GRCm39)	R117H	probably benign	Het
Kansl1l	T	C	1: 66,812,636 (GRCm39)	D459G	probably damaging	Het
Limd1	A	T	9: 123,345,942 (GRCm39)	K574*	probably null	Het
Mmrn1	A	G	6: 60,953,425 (GRCm39)	K569E	probably damaging	Het
Or51f1d	T	C	7: 102,700,789 (GRCm39)	W95R	probably damaging	Het
Ppp4r3c1	A	G	X: 88,976,005 (GRCm39)	M64T	possibly damaging	Het
Ppwd1	T	C	13: 104,356,571 (GRCm39)	M315V	probably benign	Het
Prss21	A	G	17: 24,088,563 (GRCm39)	E176G	probably benign	Het
Ptpn23	A	G	9: 110,221,581 (GRCm39)	I173T	possibly damaging	Het
Rit1	T	A	3: 88,633,377 (GRCm39)		probably null	Het
Rnf14	C	T	18: 38,441,138 (GRCm39)	A176V	probably benign	Het
Sema5a	T	A	15: 32,562,922 (GRCm39)	V311E	possibly damaging	Het
Slc28a2	C	T	2: 122,272,259 (GRCm39)	Q34*	probably null	Het
Spire1	A	C	18: 67,663,493 (GRCm39)	L36R	probably damaging	Het
Usp33	T	A	3: 152,080,258 (GRCm39)	V463E	probably damaging	Het
Vcpip1	A	G	1: 9,815,944 (GRCm39)	L813S	possibly damaging	Het
Vmn1r174	A	T	7: 23,453,429 (GRCm39)	I32F	probably benign	Het
Zbtb24	G	A	10: 41,340,577 (GRCm39)	V536M	probably damaging	Het

Other mutations in Copa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Copa	APN	1	171,938,255 (GRCm39)	missense	possibly damaging	0.87
IGL01360:Copa	APN	1	171,915,155 (GRCm39)	splice site	probably null
IGL01434:Copa	APN	1	171,947,128 (GRCm39)	missense	probably benign	0.00
IGL01744:Copa	APN	1	171,940,756 (GRCm39)	missense	probably benign	0.01
IGL01837:Copa	APN	1	171,946,419 (GRCm39)	missense	probably benign	0.01
IGL01988:Copa	APN	1	171,945,831 (GRCm39)	missense	probably benign	0.09
IGL02059:Copa	APN	1	171,927,320 (GRCm39)	missense	probably damaging	0.96
IGL02123:Copa	APN	1	171,939,695 (GRCm39)	missense	probably damaging	1.00
IGL02731:Copa	APN	1	171,929,785 (GRCm39)	missense	possibly damaging	0.77
IGL03114:Copa	APN	1	171,946,835 (GRCm39)	nonsense	probably null
P0027:Copa	UTSW	1	171,939,515 (GRCm39)	missense	possibly damaging	0.87
PIT4434001:Copa	UTSW	1	171,933,742 (GRCm39)	missense	probably benign	0.00
R0233:Copa	UTSW	1	171,915,234 (GRCm39)	critical splice donor site	probably null
R0465:Copa	UTSW	1	171,945,872 (GRCm39)	missense	probably damaging	1.00
R0547:Copa	UTSW	1	171,949,254 (GRCm39)	splice site	probably benign
R0568:Copa	UTSW	1	171,939,704 (GRCm39)	missense	possibly damaging	0.91
R0628:Copa	UTSW	1	171,918,592 (GRCm39)	splice site	probably benign
R1328:Copa	UTSW	1	171,949,258 (GRCm39)	splice site	probably benign
R1494:Copa	UTSW	1	171,931,694 (GRCm39)	missense	probably benign	0.27
R1728:Copa	UTSW	1	171,939,554 (GRCm39)	missense	probably benign
R1758:Copa	UTSW	1	171,931,711 (GRCm39)	missense	probably damaging	1.00
R1784:Copa	UTSW	1	171,939,554 (GRCm39)	missense	probably benign
R1942:Copa	UTSW	1	171,939,455 (GRCm39)	missense	probably damaging	1.00
R2054:Copa	UTSW	1	171,946,524 (GRCm39)	nonsense	probably null
R2518:Copa	UTSW	1	171,947,468 (GRCm39)	missense	probably benign
R2680:Copa	UTSW	1	171,948,971 (GRCm39)	nonsense	probably null
R3080:Copa	UTSW	1	171,940,716 (GRCm39)	missense	probably damaging	1.00
R3160:Copa	UTSW	1	171,918,800 (GRCm39)	missense	probably damaging	1.00
R3161:Copa	UTSW	1	171,918,800 (GRCm39)	missense	probably damaging	1.00
R3162:Copa	UTSW	1	171,918,800 (GRCm39)	missense	probably damaging	1.00
R3162:Copa	UTSW	1	171,918,800 (GRCm39)	missense	probably damaging	1.00
R3973:Copa	UTSW	1	171,948,812 (GRCm39)	missense	probably benign	0.00
R3975:Copa	UTSW	1	171,948,812 (GRCm39)	missense	probably benign	0.00
R4031:Copa	UTSW	1	171,935,942 (GRCm39)	missense	probably damaging	1.00
R4155:Copa	UTSW	1	171,928,992 (GRCm39)	missense	probably damaging	1.00
R4227:Copa	UTSW	1	171,945,682 (GRCm39)	intron	probably benign
R4244:Copa	UTSW	1	171,938,285 (GRCm39)	missense	probably benign	0.00
R4254:Copa	UTSW	1	171,929,811 (GRCm39)	missense	probably damaging	1.00
R4291:Copa	UTSW	1	171,919,964 (GRCm39)	intron	probably benign
R4323:Copa	UTSW	1	171,946,831 (GRCm39)	missense	probably damaging	1.00
R4402:Copa	UTSW	1	171,929,791 (GRCm39)	missense	probably damaging	1.00
R4711:Copa	UTSW	1	171,947,555 (GRCm39)	missense	probably damaging	1.00
R4721:Copa	UTSW	1	171,931,841 (GRCm39)	splice site	probably benign
R4773:Copa	UTSW	1	171,932,787 (GRCm39)	missense	probably damaging	1.00
R4794:Copa	UTSW	1	171,946,888 (GRCm39)	missense	probably damaging	1.00
R4887:Copa	UTSW	1	171,919,843 (GRCm39)	missense	probably benign	0.39
R4953:Copa	UTSW	1	171,910,453 (GRCm39)	unclassified	probably benign
R5139:Copa	UTSW	1	171,948,896 (GRCm39)	missense	probably damaging	0.99
R5152:Copa	UTSW	1	171,945,628 (GRCm39)	missense	probably benign	0.34
R5297:Copa	UTSW	1	171,940,675 (GRCm39)	missense	probably damaging	1.00
R5586:Copa	UTSW	1	171,932,789 (GRCm39)	missense	probably damaging	1.00
R5698:Copa	UTSW	1	171,946,511 (GRCm39)	nonsense	probably null
R6283:Copa	UTSW	1	171,946,415 (GRCm39)	missense	possibly damaging	0.79
R6921:Copa	UTSW	1	171,939,491 (GRCm39)	missense	possibly damaging	0.63
R6934:Copa	UTSW	1	171,938,253 (GRCm39)	missense	possibly damaging	0.64
R7009:Copa	UTSW	1	171,918,567 (GRCm39)	missense	probably damaging	0.96
R7194:Copa	UTSW	1	171,947,511 (GRCm39)	missense	probably damaging	0.99
R7348:Copa	UTSW	1	171,929,790 (GRCm39)	missense	possibly damaging	0.96
R7710:Copa	UTSW	1	171,937,411 (GRCm39)	missense	possibly damaging	0.50
R7745:Copa	UTSW	1	171,939,509 (GRCm39)	missense	probably damaging	1.00
R7893:Copa	UTSW	1	171,947,132 (GRCm39)	nonsense	probably null
R8168:Copa	UTSW	1	171,927,239 (GRCm39)	missense	probably damaging	1.00
R8273:Copa	UTSW	1	171,946,546 (GRCm39)	critical splice donor site	probably null
R8704:Copa	UTSW	1	171,931,693 (GRCm39)	missense	probably benign	0.01
R8754:Copa	UTSW	1	171,935,926 (GRCm39)	missense	probably damaging	1.00
R8757:Copa	UTSW	1	171,947,081 (GRCm39)	missense	probably benign	0.04
R8759:Copa	UTSW	1	171,947,081 (GRCm39)	missense	probably benign	0.04
R8885:Copa	UTSW	1	171,925,312 (GRCm39)	missense	probably damaging	1.00
R8891:Copa	UTSW	1	171,946,818 (GRCm39)	missense	probably damaging	1.00
R8927:Copa	UTSW	1	171,931,737 (GRCm39)	missense	probably null	0.03
R8928:Copa	UTSW	1	171,931,737 (GRCm39)	missense	probably null	0.03
R8956:Copa	UTSW	1	171,937,480 (GRCm39)	missense	possibly damaging	0.65
R9063:Copa	UTSW	1	171,944,529 (GRCm39)	missense	probably benign	0.00
R9295:Copa	UTSW	1	171,939,823 (GRCm39)	missense	probably damaging	0.99
R9364:Copa	UTSW	1	171,944,831 (GRCm39)	missense	probably benign	0.00
R9437:Copa	UTSW	1	171,931,712 (GRCm39)	missense	possibly damaging	0.93
R9673:Copa	UTSW	1	171,945,648 (GRCm39)	missense	probably benign	0.11
T0722:Copa	UTSW	1	171,939,515 (GRCm39)	missense	possibly damaging	0.87
Z1177:Copa	UTSW	1	171,933,690 (GRCm39)	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CAAGAATGTGTCTAGCAGGGTTG -3'
(R):5'- TAACCGTCAAGGCAGAGGTC -3'

Sequencing Primer
(F):5'- GCGGTGCTGGTTCTCTCAC -3'
(R):5'- CCAGAAAGTCAAGCTTGAAACTTCTG -3'

Posted On

2014-10-30