Incidental Mutation 'R2299:H3f3a'
ID245252
Institutional Source Beutler Lab
Gene Symbol H3f3a
Ensembl Gene ENSMUSG00000060743
Gene NameH3 histone, family 3A
SynonymsH3.3A
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R2299 (G1)
Quality Score171
Status Not validated
Chromosome1
Chromosomal Location180800832-180813943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 180803138 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 117 (R117H)
Ref Sequence ENSEMBL: ENSMUSP00000125104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081026] [ENSMUST00000159789] [ENSMUST00000161308] [ENSMUST00000162814]
Predicted Effect probably benign
Transcript: ENSMUST00000081026
AA Change: R116H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079816
Gene: ENSMUSG00000060743
AA Change: R116H

DomainStartEndE-ValueType
H3 34 135 2.77e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159789
AA Change: R117H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125754
Gene: ENSMUSG00000060743
AA Change: R117H

DomainStartEndE-ValueType
H3 34 119 8.9e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161308
AA Change: R117H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124509
Gene: ENSMUSG00000060743
AA Change: R117H

DomainStartEndE-ValueType
H3 34 136 4.79e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162814
AA Change: R117H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125104
Gene: ENSMUSG00000060743
AA Change: R117H

DomainStartEndE-ValueType
H3 34 136 4.79e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181811
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutants for a hypomorphic gene trap allele display partial neonatal lethality, reduced fertility, growth abnormalities and neuromuscular defects. Mice homozygous for a reporter allele exhibit reduced body size and male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in H3f3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2297:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2298:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2300:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2351:H3f3a UTSW 1 180810158 missense probably benign
R2895:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4052:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4208:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4455:H3f3a UTSW 1 180803103 missense probably benign 0.00
R5582:H3f3a UTSW 1 180810085 intron probably benign
R7870:H3f3a UTSW 1 180811925 start codon destroyed probably null 0.61
Predicted Primers PCR Primer
(F):5'- ACGCCAATACCTGATTCTGTCC -3'
(R):5'- CATCTTGACAGGTTTCTATGTGAGC -3'

Sequencing Primer
(F):5'- TCCACTCGCAATCATATACTTAGG -3'
(R):5'- GAGCGTTTGATAAATTCTTTAAAGGG -3'
Posted On2014-10-30