Mutagenetix > Incidental Mutations

Incidental Mutation 'R2299:Slc28a2'

245254

Institutional Source

Beutler Lab

Gene Symbol

Slc28a2

Ensembl Gene

ENSMUSG00000027219

Gene Name

solute carrier family 28 (sodium-coupled nucleoside transporter), member 2

Synonyms

CNT2, 2010208B10Rik

MMRRC Submission

040298-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R2299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122426477-122461137 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 122441778 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 34 (Q34*)

Ref Sequence

ENSEMBL: ENSMUSP00000106154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028652] [ENSMUST00000110524] [ENSMUST00000110525]

Predicted Effect

probably null
Transcript: ENSMUST00000028652
AA Change: Q34*

SMART Domains

Protein: ENSMUSP00000028652
Gene: ENSMUSG00000027219
AA Change: Q34*

Domain	Start	End	E-Value	Type
transmembrane domain	76	98	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	147	166	N/A	INTRINSIC
Pfam:Nucleos_tra2_N	180	253	1.5e-28	PFAM
Pfam:Gate	260	360	7.9e-11	PFAM
Pfam:Nucleos_tra2_C	363	587	1e-74	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110524
AA Change: Q34*

SMART Domains

Protein: ENSMUSP00000106153
Gene: ENSMUSG00000027219
AA Change: Q34*

Domain	Start	End	E-Value	Type
transmembrane domain	76	98	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	147	166	N/A	INTRINSIC
Pfam:Nucleos_tra2_N	180	254	8.6e-26	PFAM
Pfam:Gate	260	387	2.5e-9	PFAM
Pfam:Nucleos_tra2_C	363	588	5.1e-74	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110525
AA Change: Q34*

SMART Domains

Protein: ENSMUSP00000106154
Gene: ENSMUSG00000027219
AA Change: Q34*

Domain	Start	End	E-Value	Type
transmembrane domain	76	98	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	147	166	N/A	INTRINSIC
Pfam:Nucleos_tra2_N	180	254	8.6e-26	PFAM
Pfam:Gate	260	387	2.5e-9	PFAM
Pfam:Nucleos_tra2_C	363	588	5.1e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139850

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	G	X: 89,932,399	M64T	possibly damaging	Het
4933434E20Rik	A	G	3: 90,064,538	N68S	possibly damaging	Het
5031439G07Rik	A	C	15: 84,953,285	F276V	possibly damaging	Het
Abca12	C	T	1: 71,258,222	V2370I	probably damaging	Het
Acsl3	T	G	1: 78,699,110	C469W	probably damaging	Het
Adgrg5	A	T	8: 94,938,576	I372F	possibly damaging	Het
Ankrd42	A	G	7: 92,590,254	I442T	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bmpr1b	C	A	3: 141,845,202	R376L	probably damaging	Het
C1qtnf6	T	A	15: 78,525,342	T102S	probably benign	Het
Chordc1	T	C	9: 18,302,108	L85P	probably damaging	Het
Clec2j	T	A	6: 128,655,236		noncoding transcript	Het
Copa	T	C	1: 172,121,725	I1223T	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyfip2	T	A	11: 46,286,131	E74V	probably benign	Het
Dsg1a	A	T	18: 20,340,150	D760V	probably damaging	Het
Folr1	A	G	7: 101,863,992	L32P	probably damaging	Het
Galnt13	A	T	2: 55,060,583	R425S	possibly damaging	Het
Gm4559	A	T	7: 142,273,835	C177S	unknown	Het
H3f3a	C	T	1: 180,803,138	R117H	probably benign	Het
Hist1h2bh	A	G	13: 23,543,184	S57P	probably damaging	Het
Kansl1l	T	C	1: 66,773,477	D459G	probably damaging	Het
Limd1	A	T	9: 123,516,877	K574*	probably null	Het
Mmrn1	A	G	6: 60,976,441	K569E	probably damaging	Het
Olfr583	T	C	7: 103,051,582	W95R	probably damaging	Het
Ppwd1	T	C	13: 104,220,063	M315V	probably benign	Het
Prss21	A	G	17: 23,869,589	E176G	probably benign	Het
Ptpn23	A	G	9: 110,392,513	I173T	possibly damaging	Het
Rit1	T	A	3: 88,726,070		probably null	Het
Rnf14	C	T	18: 38,308,085	A176V	probably benign	Het
Sema5a	T	A	15: 32,562,776	V311E	possibly damaging	Het
Spire1	A	C	18: 67,530,423	L36R	probably damaging	Het
Usp33	T	A	3: 152,374,621	V463E	probably damaging	Het
Vcpip1	A	G	1: 9,745,719	L813S	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,004	I32F	probably benign	Het
Zbtb24	G	A	10: 41,464,581	V536M	probably damaging	Het

Other mutations in Slc28a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Slc28a2	APN	2	122452057	missense	probably damaging	1.00
IGL01404:Slc28a2	APN	2	122452057	missense	probably damaging	1.00
IGL01559:Slc28a2	APN	2	122454540	missense	probably damaging	1.00
IGL02016:Slc28a2	APN	2	122455341	missense	probably benign	0.01
IGL02503:Slc28a2	APN	2	122458212	missense	probably benign	0.00
IGL02576:Slc28a2	APN	2	122458171	missense	probably damaging	0.99
IGL02948:Slc28a2	APN	2	122457977	missense	possibly damaging	0.70
IGL03006:Slc28a2	APN	2	122452538	missense	possibly damaging	0.65
IGL03061:Slc28a2	APN	2	122454499	missense	probably damaging	1.00
R0028:Slc28a2	UTSW	2	122451602	missense	probably damaging	1.00
R0240:Slc28a2	UTSW	2	122454527	missense	probably benign
R0240:Slc28a2	UTSW	2	122454527	missense	probably benign
R0427:Slc28a2	UTSW	2	122458221	missense	probably benign	0.02
R0502:Slc28a2	UTSW	2	122458281	critical splice donor site	probably null
R0981:Slc28a2	UTSW	2	122450984	missense	probably damaging	1.00
R1229:Slc28a2	UTSW	2	122460531	nonsense	probably null
R1397:Slc28a2	UTSW	2	122460531	nonsense	probably null
R1641:Slc28a2	UTSW	2	122455617	missense	probably damaging	1.00
R1713:Slc28a2	UTSW	2	122451013	missense	probably damaging	1.00
R1732:Slc28a2	UTSW	2	122449758	splice site	probably benign
R1765:Slc28a2	UTSW	2	122460395	splice site	probably null
R1955:Slc28a2	UTSW	2	122447866	missense	probably benign
R1996:Slc28a2	UTSW	2	122455562	missense	probably damaging	1.00
R2300:Slc28a2	UTSW	2	122441778	nonsense	probably null
R2510:Slc28a2	UTSW	2	122451016	nonsense	probably null
R4038:Slc28a2	UTSW	2	122454515	missense	probably benign	0.03
R4893:Slc28a2	UTSW	2	122455216	splice site	probably null
R5011:Slc28a2	UTSW	2	122457890	missense	possibly damaging	0.94
R5013:Slc28a2	UTSW	2	122457890	missense	possibly damaging	0.94
R5185:Slc28a2	UTSW	2	122458194	missense	probably benign	0.04
R6317:Slc28a2	UTSW	2	122454499	missense	possibly damaging	0.77
R7181:Slc28a2	UTSW	2	122451981	critical splice acceptor site	probably null
R8147:Slc28a2	UTSW	2	122458201	missense	probably benign	0.04
R8528:Slc28a2	UTSW	2	122455742	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAAAGTCTGTTTCCCAGGC -3'
(R):5'- ACATGCAGTGATCCTGATGG -3'

Sequencing Primer
(F):5'- TGTTTCCCAGGCCACAGTG -3'
(R):5'- AGCAATCTAAGAATGAGTAGCTTCG -3'

Posted On

2014-10-30