Incidental Mutation 'R2299:Slc28a2'
ID245254
Institutional Source Beutler Lab
Gene Symbol Slc28a2
Ensembl Gene ENSMUSG00000027219
Gene Namesolute carrier family 28 (sodium-coupled nucleoside transporter), member 2
SynonymsCNT2, 2010208B10Rik
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122426477-122461137 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 122441778 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 34 (Q34*)
Ref Sequence ENSEMBL: ENSMUSP00000106154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028652] [ENSMUST00000110524] [ENSMUST00000110525]
Predicted Effect probably null
Transcript: ENSMUST00000028652
AA Change: Q34*
SMART Domains Protein: ENSMUSP00000028652
Gene: ENSMUSG00000027219
AA Change: Q34*

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 1.5e-28 PFAM
Pfam:Gate 260 360 7.9e-11 PFAM
Pfam:Nucleos_tra2_C 363 587 1e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110524
AA Change: Q34*
SMART Domains Protein: ENSMUSP00000106153
Gene: ENSMUSG00000027219
AA Change: Q34*

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 254 8.6e-26 PFAM
Pfam:Gate 260 387 2.5e-9 PFAM
Pfam:Nucleos_tra2_C 363 588 5.1e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110525
AA Change: Q34*
SMART Domains Protein: ENSMUSP00000106154
Gene: ENSMUSG00000027219
AA Change: Q34*

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 254 8.6e-26 PFAM
Pfam:Gate 260 387 2.5e-9 PFAM
Pfam:Nucleos_tra2_C 363 588 5.1e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139850
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Slc28a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Slc28a2 APN 2 122452057 missense probably damaging 1.00
IGL01404:Slc28a2 APN 2 122452057 missense probably damaging 1.00
IGL01559:Slc28a2 APN 2 122454540 missense probably damaging 1.00
IGL02016:Slc28a2 APN 2 122455341 missense probably benign 0.01
IGL02503:Slc28a2 APN 2 122458212 missense probably benign 0.00
IGL02576:Slc28a2 APN 2 122458171 missense probably damaging 0.99
IGL02948:Slc28a2 APN 2 122457977 missense possibly damaging 0.70
IGL03006:Slc28a2 APN 2 122452538 missense possibly damaging 0.65
IGL03061:Slc28a2 APN 2 122454499 missense probably damaging 1.00
R0028:Slc28a2 UTSW 2 122451602 missense probably damaging 1.00
R0240:Slc28a2 UTSW 2 122454527 missense probably benign
R0240:Slc28a2 UTSW 2 122454527 missense probably benign
R0427:Slc28a2 UTSW 2 122458221 missense probably benign 0.02
R0502:Slc28a2 UTSW 2 122458281 critical splice donor site probably null
R0981:Slc28a2 UTSW 2 122450984 missense probably damaging 1.00
R1229:Slc28a2 UTSW 2 122460531 nonsense probably null
R1397:Slc28a2 UTSW 2 122460531 nonsense probably null
R1641:Slc28a2 UTSW 2 122455617 missense probably damaging 1.00
R1713:Slc28a2 UTSW 2 122451013 missense probably damaging 1.00
R1732:Slc28a2 UTSW 2 122449758 splice site probably benign
R1765:Slc28a2 UTSW 2 122460395 splice site probably null
R1955:Slc28a2 UTSW 2 122447866 missense probably benign
R1996:Slc28a2 UTSW 2 122455562 missense probably damaging 1.00
R2300:Slc28a2 UTSW 2 122441778 nonsense probably null
R2510:Slc28a2 UTSW 2 122451016 nonsense probably null
R4038:Slc28a2 UTSW 2 122454515 missense probably benign 0.03
R4893:Slc28a2 UTSW 2 122455216 splice site probably null
R5011:Slc28a2 UTSW 2 122457890 missense possibly damaging 0.94
R5013:Slc28a2 UTSW 2 122457890 missense possibly damaging 0.94
R5185:Slc28a2 UTSW 2 122458194 missense probably benign 0.04
R6317:Slc28a2 UTSW 2 122454499 missense possibly damaging 0.77
R7181:Slc28a2 UTSW 2 122451981 critical splice acceptor site probably null
R8147:Slc28a2 UTSW 2 122458201 missense probably benign 0.04
R8528:Slc28a2 UTSW 2 122455742 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAAGTCTGTTTCCCAGGC -3'
(R):5'- ACATGCAGTGATCCTGATGG -3'

Sequencing Primer
(F):5'- TGTTTCCCAGGCCACAGTG -3'
(R):5'- AGCAATCTAAGAATGAGTAGCTTCG -3'
Posted On2014-10-30