Incidental Mutation 'R2299:Rit1'
ID245255
Institutional Source Beutler Lab
Gene Symbol Rit1
Ensembl Gene ENSMUSG00000028057
Gene NameRas-like without CAAX 1
SynonymsRit
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88716838-88731049 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 88726070 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029692] [ENSMUST00000170377] [ENSMUST00000171645] [ENSMUST00000172252] [ENSMUST00000172333]
Predicted Effect probably null
Transcript: ENSMUST00000029692
SMART Domains Protein: ENSMUSP00000029692
Gene: ENSMUSG00000028057

DomainStartEndE-ValueType
RAS 19 185 7.95e-114 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166234
Predicted Effect probably benign
Transcript: ENSMUST00000170377
AA Change: V80E

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125858
Gene: ENSMUSG00000028057
AA Change: V80E

DomainStartEndE-ValueType
Pfam:Ras 23 81 4.1e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171645
SMART Domains Protein: ENSMUSP00000127206
Gene: ENSMUSG00000028057

DomainStartEndE-ValueType
Pfam:Miro 23 109 1.1e-10 PFAM
Pfam:Ras 23 109 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172187
Predicted Effect probably null
Transcript: ENSMUST00000172252
SMART Domains Protein: ENSMUSP00000130464
Gene: ENSMUSG00000028057

DomainStartEndE-ValueType
RAS 1 149 4.73e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172333
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of Ras-related GTPases. The encoded protein is involved in regulating p38 MAPK-dependent signaling cascades related to cellular stress. This protein also cooperates with nerve growth factor to promote neuronal development and regeneration. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele produce embryonic fibroblasts that exhibit increased cellular sensitivity to hydrogen peroxide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Rit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Rit1 APN 3 88726431 missense probably damaging 1.00
R1520:Rit1 UTSW 3 88729313 missense probably benign 0.00
R1837:Rit1 UTSW 3 88729170 missense probably damaging 1.00
R1838:Rit1 UTSW 3 88729170 missense probably damaging 1.00
R4745:Rit1 UTSW 3 88717675 unclassified probably benign
R5564:Rit1 UTSW 3 88726150 intron probably benign
R5594:Rit1 UTSW 3 88729137 missense probably damaging 1.00
R6606:Rit1 UTSW 3 88717638 missense probably damaging 1.00
R6773:Rit1 UTSW 3 88726369 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGGCTTCTTCCTGCATGTGAG -3'
(R):5'- TGAAGCGCAGACTTCCACAC -3'

Sequencing Primer
(F):5'- AACTCACTTTGTAGACTAGGCTGGC -3'
(R):5'- GACTTCCACACGCGCACTG -3'
Posted On2014-10-30