Incidental Mutation 'R2299:4933434E20Rik'
ID245256
Institutional Source Beutler Lab
Gene Symbol 4933434E20Rik
Ensembl Gene ENSMUSG00000027942
Gene NameRIKEN cDNA 4933434E20 gene
Synonyms
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90051636-90068347 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90064538 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 68 (N68S)
Ref Sequence ENSEMBL: ENSMUSP00000029551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029551] [ENSMUST00000068798] [ENSMUST00000159064] [ENSMUST00000160640] [ENSMUST00000161918] [ENSMUST00000162114]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029551
AA Change: N68S

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029551
Gene: ENSMUSG00000027942
AA Change: N68S

DomainStartEndE-ValueType
Pfam:DUF4558 20 105 1.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068798
SMART Domains Protein: ENSMUSP00000066840
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 171 2.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159064
SMART Domains Protein: ENSMUSP00000124554
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 6 188 4.2e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160640
SMART Domains Protein: ENSMUSP00000124028
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 3.2e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161918
SMART Domains Protein: ENSMUSP00000123740
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 64 2.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162114
SMART Domains Protein: ENSMUSP00000124822
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 1.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162390
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in 4933434E20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:4933434E20Rik APN 3 90053093 missense possibly damaging 0.65
IGL01621:4933434E20Rik APN 3 90064502 missense possibly damaging 0.82
IGL01984:4933434E20Rik APN 3 90063230 missense probably benign 0.00
IGL02005:4933434E20Rik APN 3 90058620 missense probably damaging 1.00
R0446:4933434E20Rik UTSW 3 90064459 missense probably benign 0.00
R1717:4933434E20Rik UTSW 3 90056237 missense probably benign 0.23
R1816:4933434E20Rik UTSW 3 90053091 missense possibly damaging 0.89
R2170:4933434E20Rik UTSW 3 90056304 missense probably benign 0.07
R2981:4933434E20Rik UTSW 3 90058631 missense probably benign 0.00
R3879:4933434E20Rik UTSW 3 90063254 unclassified probably benign
R4065:4933434E20Rik UTSW 3 90058766 nonsense probably null
R4724:4933434E20Rik UTSW 3 90053541 missense probably damaging 1.00
R4724:4933434E20Rik UTSW 3 90053542 missense probably damaging 1.00
R4724:4933434E20Rik UTSW 3 90053583 missense probably damaging 0.99
R4835:4933434E20Rik UTSW 3 90063209 missense probably benign 0.22
R5076:4933434E20Rik UTSW 3 90056252 missense probably benign 0.01
R6126:4933434E20Rik UTSW 3 90056574 missense probably damaging 0.98
R6337:4933434E20Rik UTSW 3 90061733 missense probably benign 0.03
R6562:4933434E20Rik UTSW 3 90063236 missense probably benign 0.38
R7312:4933434E20Rik UTSW 3 90061714 missense probably benign 0.07
R7316:4933434E20Rik UTSW 3 90061713 missense probably benign
R7473:4933434E20Rik UTSW 3 90058653 critical splice donor site probably null
R7990:4933434E20Rik UTSW 3 90063242 missense probably damaging 0.98
R8125:4933434E20Rik UTSW 3 90065511 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCTGCATCTGACTCTATTCATGG -3'
(R):5'- CTCAGAGGCAAATGATATGGTTAAGTC -3'

Sequencing Primer
(F):5'- GTCAGTTCAAAGCAGCGGATCC -3'
(R):5'- GCAAATGATATGGTTAAGTCGAGAG -3'
Posted On2014-10-30