Incidental Mutation 'R2299:Usp33'
ID245258
Institutional Source Beutler Lab
Gene Symbol Usp33
Ensembl Gene ENSMUSG00000025437
Gene Nameubiquitin specific peptidase 33
SynonymsVdu1, 9830169D19Rik
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.820) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location152346478-152393617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152374621 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 463 (V463E)
Ref Sequence ENSEMBL: ENSMUSP00000026507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026507] [ENSMUST00000117492] [ENSMUST00000123237] [ENSMUST00000197748]
Predicted Effect probably damaging
Transcript: ENSMUST00000026507
AA Change: V463E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026507
Gene: ENSMUSG00000025437
AA Change: V463E

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1.7e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 671 2.2e-71 PFAM
Pfam:UCH_1 154 387 1.4e-9 PFAM
Pfam:UCH_1 371 653 6.8e-25 PFAM
DUSP 691 774 4.4e-17 SMART
DUSP 799 883 2.44e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117492
AA Change: V463E

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113265
Gene: ENSMUSG00000025437
AA Change: V463E

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 679 1.6e-64 PFAM
Pfam:UCH_1 154 387 1.2e-8 PFAM
Pfam:UCH_1 366 661 1.3e-23 PFAM
DUSP 699 782 4.4e-17 SMART
DUSP 807 891 2.44e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123237
SMART Domains Protein: ENSMUSP00000117590
Gene: ENSMUSG00000025437

DomainStartEndE-ValueType
PDB:2UZG|A 5 45 2e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000197600
Predicted Effect probably benign
Transcript: ENSMUST00000197748
AA Change: V463E

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142708
Gene: ENSMUSG00000025437
AA Change: V463E

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1.7e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 679 2.3e-71 PFAM
Pfam:UCH_1 154 383 1.2e-9 PFAM
Pfam:UCH_1 368 661 1e-24 PFAM
DUSP 699 782 4.4e-17 SMART
DUSP 807 891 2.44e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198950
Meta Mutation Damage Score 0.2707 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquinating enzyme important in a variety of processes, including Slit-dependent cell migration and beta-2 adrenergic receptor signaling. The protein is negatively regulated through ubiquitination by von Hippel-Lindau tumor protein (VHL). Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Usp33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Usp33 APN 3 152373409 missense probably benign 0.00
IGL01085:Usp33 APN 3 152368569 missense possibly damaging 0.89
IGL01335:Usp33 APN 3 152392217 missense probably damaging 0.99
IGL02095:Usp33 APN 3 152381794 missense possibly damaging 0.94
IGL02323:Usp33 APN 3 152370387 missense probably benign
IGL03010:Usp33 APN 3 152368596 missense probably benign 0.04
R0464:Usp33 UTSW 3 152376235 splice site probably benign
R0576:Usp33 UTSW 3 152384119 nonsense probably null
R0583:Usp33 UTSW 3 152368254 missense probably damaging 1.00
R0715:Usp33 UTSW 3 152380574 missense probably damaging 1.00
R1445:Usp33 UTSW 3 152368634 missense probably damaging 0.99
R1507:Usp33 UTSW 3 152374763 missense possibly damaging 0.84
R1600:Usp33 UTSW 3 152379610 missense probably damaging 0.98
R1673:Usp33 UTSW 3 152368282 missense probably damaging 1.00
R1945:Usp33 UTSW 3 152379586 missense probably benign 0.07
R1961:Usp33 UTSW 3 152380628 missense probably damaging 1.00
R1973:Usp33 UTSW 3 152360286 missense possibly damaging 0.64
R2231:Usp33 UTSW 3 152373386 missense probably benign 0.00
R3001:Usp33 UTSW 3 152357942 missense probably damaging 0.99
R3002:Usp33 UTSW 3 152357942 missense probably damaging 0.99
R3923:Usp33 UTSW 3 152374791 critical splice donor site probably null
R4366:Usp33 UTSW 3 152368512 missense probably benign 0.44
R4821:Usp33 UTSW 3 152358673 missense probably benign 0.00
R5256:Usp33 UTSW 3 152391696 nonsense probably null
R5396:Usp33 UTSW 3 152384187 missense possibly damaging 0.77
R5445:Usp33 UTSW 3 152374623 missense probably damaging 1.00
R5877:Usp33 UTSW 3 152379476 missense possibly damaging 0.91
R5877:Usp33 UTSW 3 152379596 missense probably damaging 1.00
R5884:Usp33 UTSW 3 152368330 missense probably benign
R5913:Usp33 UTSW 3 152380592 missense probably damaging 1.00
R5920:Usp33 UTSW 3 152374683 missense probably damaging 1.00
R6331:Usp33 UTSW 3 152376250 missense probably damaging 1.00
R6516:Usp33 UTSW 3 152373416 missense probably benign 0.01
R6624:Usp33 UTSW 3 152381798 missense probably damaging 1.00
R6679:Usp33 UTSW 3 152368487 missense possibly damaging 0.46
R7196:Usp33 UTSW 3 152384191 missense possibly damaging 0.87
R7250:Usp33 UTSW 3 152392362 nonsense probably null
R7310:Usp33 UTSW 3 152360389 nonsense probably null
R7569:Usp33 UTSW 3 152391665 missense probably damaging 1.00
R7644:Usp33 UTSW 3 152357952 missense possibly damaging 0.47
R8118:Usp33 UTSW 3 152360359 missense probably damaging 1.00
R8229:Usp33 UTSW 3 152370292 missense probably benign
R8333:Usp33 UTSW 3 152374660 missense probably damaging 1.00
X0025:Usp33 UTSW 3 152366758 missense probably damaging 1.00
X0058:Usp33 UTSW 3 152360346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTCTGAGCTGCAGGAG -3'
(R):5'- CTAGTACAGCAGAAGCAGCAGC -3'

Sequencing Primer
(F):5'- ATCTCTGAGCTGCAGGAGTACTAATG -3'
(R):5'- GCAGCAGCATCAACATCAATG -3'
Posted On2014-10-30