Incidental Mutation 'R2299:Vmn1r174'
ID245261
Institutional Source Beutler Lab
Gene Symbol Vmn1r174
Ensembl Gene ENSMUSG00000090411
Gene Namevomeronasal 1 receptor 174
SynonymsV1rd22
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2299 (G1)
Quality Score196
Status Validated
Chromosome7
Chromosomal Location23752270-23762403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23754004 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 32 (I32F)
Ref Sequence ENSEMBL: ENSMUSP00000154506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167551] [ENSMUST00000228331]
Predicted Effect probably benign
Transcript: ENSMUST00000167551
AA Change: I32F

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126478
Gene: ENSMUSG00000090411
AA Change: I32F

DomainStartEndE-ValueType
Pfam:TAS2R 8 300 4e-9 PFAM
Pfam:V1R 43 300 5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228331
AA Change: I32F

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Vmn1r174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Vmn1r174 APN 7 23754533 missense possibly damaging 0.77
IGL00950:Vmn1r174 APN 7 23754486 missense possibly damaging 0.96
IGL01484:Vmn1r174 APN 7 23754324 nonsense probably null
IGL02014:Vmn1r174 APN 7 23754158 missense probably damaging 1.00
IGL02190:Vmn1r174 APN 7 23754827 missense unknown
IGL03265:Vmn1r174 APN 7 23754473 nonsense probably null
IGL03335:Vmn1r174 APN 7 23754512 missense probably benign 0.41
R0529:Vmn1r174 UTSW 7 23754197 missense probably benign 0.00
R1489:Vmn1r174 UTSW 7 23754556 nonsense probably null
R1645:Vmn1r174 UTSW 7 23754352 missense possibly damaging 0.87
R1691:Vmn1r174 UTSW 7 23753912 start codon destroyed probably null 1.00
R1753:Vmn1r174 UTSW 7 23754197 missense probably benign 0.00
R1939:Vmn1r174 UTSW 7 23754107 missense probably damaging 0.99
R1988:Vmn1r174 UTSW 7 23754625 missense probably damaging 0.98
R4429:Vmn1r174 UTSW 7 23754140 missense probably benign 0.02
R4516:Vmn1r174 UTSW 7 23754343 missense probably benign 0.01
R4589:Vmn1r174 UTSW 7 23754779 nonsense probably null
R5175:Vmn1r174 UTSW 7 23754728 missense probably benign 0.03
R5392:Vmn1r174 UTSW 7 23754802 missense unknown
R5503:Vmn1r174 UTSW 7 23754137 missense probably benign 0.03
R5568:Vmn1r174 UTSW 7 23754494 missense probably damaging 0.96
R6705:Vmn1r174 UTSW 7 23754426 missense probably benign 0.25
R8168:Vmn1r174 UTSW 7 23754671 missense probably damaging 0.99
R8190:Vmn1r174 UTSW 7 23754143 missense probably damaging 1.00
X0011:Vmn1r174 UTSW 7 23754481 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGGTGTCTTCTTACCCAGG -3'
(R):5'- AGTACTCAAGCTTACAGTTGAGG -3'

Sequencing Primer
(F):5'- GGTGTCTTCTTACCCAGGAAAATAC -3'
(R):5'- ACAGTTGAGGTCATTTAGAGGATTCC -3'
Posted On2014-10-30