Incidental Mutation 'R2299:Ankrd42'
ID245263
Institutional Source Beutler Lab
Gene Symbol Ankrd42
Ensembl Gene ENSMUSG00000041343
Gene Nameankyrin repeat domain 42
Synonyms4933417L02Rik, Ikbn
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2299 (G1)
Quality Score219
Status Validated
Chromosome7
Chromosomal Location92581723-92637142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92590254 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 442 (I442T)
Ref Sequence ENSEMBL: ENSMUSP00000113767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056106] [ENSMUST00000118157] [ENSMUST00000126305]
Predicted Effect probably benign
Transcript: ENSMUST00000056106
AA Change: I442T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000061208
Gene: ENSMUSG00000041343
AA Change: I442T

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 1.48e-3 SMART
ANK 158 187 2.11e2 SMART
ANK 191 220 9.78e-4 SMART
ANK 263 293 1.33e2 SMART
ANK 297 326 1.22e-4 SMART
coiled coil region 437 489 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118157
AA Change: I442T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113767
Gene: ENSMUSG00000041343
AA Change: I442T

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 1.48e-3 SMART
ANK 158 187 2.11e2 SMART
ANK 191 220 9.78e-4 SMART
ANK 263 293 1.33e2 SMART
ANK 297 326 1.22e-4 SMART
coiled coil region 437 489 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126305
SMART Domains Protein: ENSMUSP00000123315
Gene: ENSMUSG00000041343

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 2.92e-2 SMART
Meta Mutation Damage Score 0.0883 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Ankrd42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ankrd42 APN 7 92584454 utr 3 prime probably benign
IGL01151:Ankrd42 APN 7 92605200 unclassified probably benign
IGL01444:Ankrd42 APN 7 92610585 missense probably damaging 0.96
IGL01933:Ankrd42 APN 7 92605285 missense probably benign
IGL03195:Ankrd42 APN 7 92591858 missense probably benign 0.33
IGL03397:Ankrd42 APN 7 92619554 missense probably damaging 1.00
R0128:Ankrd42 UTSW 7 92591859 nonsense probably null
R0278:Ankrd42 UTSW 7 92631657 missense possibly damaging 0.82
R0839:Ankrd42 UTSW 7 92612772 missense possibly damaging 0.92
R1227:Ankrd42 UTSW 7 92605300 missense possibly damaging 0.53
R1603:Ankrd42 UTSW 7 92619691 intron probably benign
R2281:Ankrd42 UTSW 7 92625773 nonsense probably null
R2324:Ankrd42 UTSW 7 92623978 missense probably damaging 0.98
R2874:Ankrd42 UTSW 7 92605358 missense possibly damaging 0.71
R3940:Ankrd42 UTSW 7 92591788 splice site probably null
R4998:Ankrd42 UTSW 7 92624074 missense possibly damaging 0.71
R5579:Ankrd42 UTSW 7 92590182 missense possibly damaging 0.96
R5954:Ankrd42 UTSW 7 92623967 critical splice donor site probably null
R6140:Ankrd42 UTSW 7 92591828 splice site probably null
R6924:Ankrd42 UTSW 7 92582016 unclassified probably benign
R6944:Ankrd42 UTSW 7 92619547 critical splice donor site probably null
R7096:Ankrd42 UTSW 7 92591832 nonsense probably null
R7101:Ankrd42 UTSW 7 92631544 missense possibly damaging 0.53
R7155:Ankrd42 UTSW 7 92591933 missense possibly damaging 0.72
R7410:Ankrd42 UTSW 7 92610554 missense possibly damaging 0.93
R7500:Ankrd42 UTSW 7 92591872 missense probably benign 0.33
R7640:Ankrd42 UTSW 7 92619635 missense probably benign 0.14
R7737:Ankrd42 UTSW 7 92605262 missense possibly damaging 0.53
X0065:Ankrd42 UTSW 7 92610555 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGACAGGATTCAAATTCACCCC -3'
(R):5'- TGGTACCTTCTAGCACACCAC -3'

Sequencing Primer
(F):5'- CTCAAAGCTTACAATTTTAGCCAC -3'
(R):5'- ACCTTCTAGCACACCACATATTTTAC -3'
Posted On2014-10-30