Incidental Mutation 'R2299:Folr1'
ID245264
Institutional Source Beutler Lab
Gene Symbol Folr1
Ensembl Gene ENSMUSG00000001827
Gene Namefolate receptor 1 (adult)
SynonymsFolbp-1, folate receptor [a], Folbp1, folate-binding protein 1, FBP1
MMRRC Submission 040298-MU
Accession Numbers

Ncbi RefSeq: NM_001252552.1, NM_008034.3, NM_001252553.1, NM_001252554.1; MGI:95568

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101858331-101870788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101863992 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 32 (L32P)
Ref Sequence ENSEMBL: ENSMUSP00000115360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106981] [ENSMUST00000106982] [ENSMUST00000106983] [ENSMUST00000106985] [ENSMUST00000106986] [ENSMUST00000123321] [ENSMUST00000123630] [ENSMUST00000124026] [ENSMUST00000126204] [ENSMUST00000134145] [ENSMUST00000140068] [ENSMUST00000140584] [ENSMUST00000150184] [ENSMUST00000151706] [ENSMUST00000155311] [ENSMUST00000209334]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106981
AA Change: L32P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102594
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106982
AA Change: L32P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102595
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106983
AA Change: L32P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102596
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 4.2e-68 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106985
AA Change: L32P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102598
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106986
AA Change: L32P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102599
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 209 2.4e-61 PFAM
low complexity region 242 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123321
AA Change: L32P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114167
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 54 6e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000123630
AA Change: L32P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121947
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 54 4e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125298
Predicted Effect possibly damaging
Transcript: ENSMUST00000126204
AA Change: L32P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117175
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 137 2.9e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134145
AA Change: L32P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118547
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 104 2.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140068
AA Change: L32P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114633
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 160 9.5e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140584
Predicted Effect probably damaging
Transcript: ENSMUST00000150184
AA Change: L32P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000151706
AA Change: L32P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115077
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Folate_rec 34 157 8.9e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155311
AA Change: L32P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115360
Gene: ENSMUSG00000001827
AA Change: L32P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:4LRH|H 21 53 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000209334
Meta Mutation Damage Score 0.8298 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype Strain: 2383986
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Embryos homozygous for a knock-out allele are growth retarded and malformed, show multiple developmental anomalies, including neural and craniofacial defects, and die by E10. Folate supplementation of pregnant dams reduces embryonic mortality and improves many of the adverse developmental effects. [provided by MGI curators]
Allele List at MGI

All alleles(359) : Targeted(3) Gene trapped(356)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Folr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Folr1 APN 7 101858740 missense probably benign 0.00
IGL02423:Folr1 APN 7 101858525 missense probably benign 0.00
R0071:Folr1 UTSW 7 101863923 critical splice donor site probably null
R0071:Folr1 UTSW 7 101863923 critical splice donor site probably null
R1022:Folr1 UTSW 7 101858603 missense probably damaging 0.98
R1024:Folr1 UTSW 7 101858603 missense probably damaging 0.98
R1562:Folr1 UTSW 7 101858594 missense probably damaging 0.98
R3690:Folr1 UTSW 7 101858538 missense probably benign 0.06
R4746:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R4747:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R5319:Folr1 UTSW 7 101863977 missense probably damaging 1.00
R6243:Folr1 UTSW 7 101863965 missense probably damaging 1.00
R6275:Folr1 UTSW 7 101859535 missense probably damaging 0.99
R7284:Folr1 UTSW 7 101859470 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AAGGTCTCCTCAGGTAGGTC -3'
(R):5'- TCTGAGCCTCACAGAGTCTG -3'

Sequencing Primer
(F):5'- TCAGGTAGGTCTGACCACCTC -3'
(R):5'- CCTCACAGAGTCTGGGAAGACTG -3'
Posted On2014-10-30