Incidental Mutation 'R2299:Olfr583'
ID245265
Institutional Source Beutler Lab
Gene Symbol Olfr583
Ensembl Gene ENSMUSG00000073960
Gene Nameolfactory receptor 583
SynonymsMOR14-6, GA_x6K02T2PBJ9-5762668-5763618
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103051300-103052259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103051582 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 95 (W95R)
Ref Sequence ENSEMBL: ENSMUSP00000095812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098211]
Predicted Effect probably damaging
Transcript: ENSMUST00000098211
AA Change: W95R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095812
Gene: ENSMUSG00000073960
AA Change: W95R

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 9.1e-107 PFAM
Pfam:7TM_GPCR_Srsx 45 316 1.4e-5 PFAM
Pfam:7tm_1 50 301 9.6e-20 PFAM
Meta Mutation Damage Score 0.7319 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Olfr583
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Olfr583 APN 7 103051375 missense probably benign 0.02
IGL02200:Olfr583 APN 7 103051793 missense probably benign
IGL02412:Olfr583 APN 7 103052152 missense probably benign 0.01
IGL02452:Olfr583 APN 7 103051931 missense probably benign 0.00
IGL02859:Olfr583 APN 7 103052138 missense probably benign 0.00
IGL03078:Olfr583 APN 7 103051829 missense probably damaging 1.00
R0675:Olfr583 UTSW 7 103051702 missense probably benign 0.22
R1474:Olfr583 UTSW 7 103052081 missense probably damaging 1.00
R1531:Olfr583 UTSW 7 103051588 missense probably benign 0.00
R1535:Olfr583 UTSW 7 103051369 missense probably benign 0.14
R1777:Olfr583 UTSW 7 103051376 missense probably benign 0.41
R1883:Olfr583 UTSW 7 103051982 missense probably benign 0.00
R1884:Olfr583 UTSW 7 103051982 missense probably benign 0.00
R2265:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2267:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R2269:Olfr583 UTSW 7 103052137 missense probably benign 0.00
R3802:Olfr583 UTSW 7 103052165 missense probably benign 0.05
R4239:Olfr583 UTSW 7 103051796 missense probably benign 0.17
R4426:Olfr583 UTSW 7 103051811 missense probably damaging 1.00
R5335:Olfr583 UTSW 7 103051535 missense probably damaging 1.00
R6048:Olfr583 UTSW 7 103051319 missense probably benign 0.00
R6270:Olfr583 UTSW 7 103051331 missense probably benign 0.27
R6837:Olfr583 UTSW 7 103051722 nonsense probably null
R7257:Olfr583 UTSW 7 103051630 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGTCTGCTCATGGCTGGATC -3'
(R):5'- TAGTAGAGTGTGCATTATCACTAGG -3'

Sequencing Primer
(F):5'- GCTCATGGCTGGATCTCCATC -3'
(R):5'- GAGTGTGCATTATCACTAGGAAACC -3'
Posted On2014-10-30