Incidental Mutation 'R2299:Adgrg5'
ID245267
Institutional Source Beutler Lab
Gene Symbol Adgrg5
Ensembl Gene ENSMUSG00000061577
Gene Nameadhesion G protein-coupled receptor G5
SynonymsGpr114, PGR27, LOC382045
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94923694-94943280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94938576 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 372 (I372F)
Ref Sequence ENSEMBL: ENSMUSP00000132628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074570] [ENSMUST00000128308] [ENSMUST00000153448] [ENSMUST00000166802]
Predicted Effect probably benign
Transcript: ENSMUST00000074570
AA Change: I371F

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074155
Gene: ENSMUSG00000061577
AA Change: I371F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 4.7e-13 SMART
Pfam:7tm_2 240 494 2.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128308
SMART Domains Protein: ENSMUSP00000120217
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 83 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142991
Predicted Effect probably benign
Transcript: ENSMUST00000153448
SMART Domains Protein: ENSMUSP00000122780
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166802
AA Change: I372F

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132628
Gene: ENSMUSG00000061577
AA Change: I372F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 1.37e-14 SMART
Pfam:7tm_2 241 495 1.3e-36 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adhesion family of G-protein coupled receptors. Members of this family are characterized by long N-termini and multiple functional domains. They may play a role in the immune system as well as in the central nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Adgrg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Adgrg5 APN 8 94937629 missense probably damaging 1.00
IGL02617:Adgrg5 APN 8 94933982 missense probably benign 0.01
R0483:Adgrg5 UTSW 8 94933508 missense possibly damaging 0.73
R0539:Adgrg5 UTSW 8 94938632 missense probably damaging 1.00
R0580:Adgrg5 UTSW 8 94937344 critical splice donor site probably null
R0650:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0652:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0828:Adgrg5 UTSW 8 94941785 splice site probably null
R1546:Adgrg5 UTSW 8 94941630 missense probably benign 0.27
R1567:Adgrg5 UTSW 8 94937698 missense probably damaging 0.97
R1695:Adgrg5 UTSW 8 94937745 missense probably damaging 1.00
R1753:Adgrg5 UTSW 8 94942052 missense possibly damaging 0.65
R1852:Adgrg5 UTSW 8 94937800 missense probably damaging 1.00
R2018:Adgrg5 UTSW 8 94934480 missense probably damaging 1.00
R2051:Adgrg5 UTSW 8 94942067 missense probably benign 0.01
R2190:Adgrg5 UTSW 8 94933951 missense probably damaging 1.00
R2568:Adgrg5 UTSW 8 94934021 missense probably damaging 0.99
R4283:Adgrg5 UTSW 8 94937698 missense probably benign 0.21
R4512:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R4825:Adgrg5 UTSW 8 94941734 missense possibly damaging 0.77
R5422:Adgrg5 UTSW 8 94933952 missense probably damaging 1.00
R5427:Adgrg5 UTSW 8 94935102 missense probably benign 0.27
R6186:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R6522:Adgrg5 UTSW 8 94942068 missense probably benign 0.13
R6608:Adgrg5 UTSW 8 94941720 missense probably damaging 1.00
R6810:Adgrg5 UTSW 8 94933942 missense probably damaging 0.97
R6816:Adgrg5 UTSW 8 94941683 missense probably damaging 0.99
R7214:Adgrg5 UTSW 8 94934018 missense
R7686:Adgrg5 UTSW 8 94937802 missense
R7955:Adgrg5 UTSW 8 94937697 missense
X0027:Adgrg5 UTSW 8 94937338 missense probably benign 0.07
Z1176:Adgrg5 UTSW 8 94935151 missense
Predicted Primers PCR Primer
(F):5'- AGCCTCTTCTGAGACAAACGTC -3'
(R):5'- TGGCAGAACCCTGTGGAATC -3'

Sequencing Primer
(F):5'- TGAGACAAACGTCCTGACTCTGAG -3'
(R):5'- ACTTCACCATAGAGGACCTC -3'
Posted On2014-10-30