Incidental Mutation 'R2299:Chordc1'
ID245268
Institutional Source Beutler Lab
Gene Symbol Chordc1
Ensembl Gene ENSMUSG00000001774
Gene Namecysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1
SynonymsChp-1, 1110001O09Rik, morgana
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2299 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location18292125-18317442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18302108 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 85 (L85P)
Ref Sequence ENSEMBL: ENSMUSP00000150527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001825] [ENSMUST00000213605] [ENSMUST00000216800] [ENSMUST00000217031] [ENSMUST00000217083]
Predicted Effect probably benign
Transcript: ENSMUST00000001825
AA Change: L85P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000001825
Gene: ENSMUSG00000001774
AA Change: L85P

DomainStartEndE-ValueType
Pfam:CHORD 3 64 3.4e-32 PFAM
low complexity region 67 89 N/A INTRINSIC
low complexity region 132 154 N/A INTRINSIC
Pfam:CHORD 155 216 4.5e-29 PFAM
Pfam:CS 230 306 4.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213605
AA Change: L85P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216666
Predicted Effect probably damaging
Transcript: ENSMUST00000216800
AA Change: L85P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217031
AA Change: L85P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217083
AA Change: L85P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217524
Meta Mutation Damage Score 0.0622 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before somite formation with decreased proliferation and increased apoptosis of cultured inner cell masse cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Zbtb24 G A 10: 41,464,581 V536M probably damaging Het
Other mutations in Chordc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Chordc1 APN 9 18302092 missense possibly damaging 0.84
IGL03155:Chordc1 APN 9 18304320 missense possibly damaging 0.88
IGL03343:Chordc1 APN 9 18312466 missense probably damaging 0.98
garner UTSW 9 18295332 missense probably damaging 1.00
R1830:Chordc1 UTSW 9 18311978 missense probably damaging 1.00
R4797:Chordc1 UTSW 9 18292376 unclassified probably benign
R4808:Chordc1 UTSW 9 18292413 missense probably damaging 1.00
R5086:Chordc1 UTSW 9 18312835 missense probably benign 0.00
R5667:Chordc1 UTSW 9 18295332 missense probably damaging 1.00
R5929:Chordc1 UTSW 9 18304362 missense possibly damaging 0.86
R7212:Chordc1 UTSW 9 18295351 critical splice donor site probably null
R7212:Chordc1 UTSW 9 18301012 missense probably damaging 1.00
R7605:Chordc1 UTSW 9 18304372 missense probably benign 0.01
R7726:Chordc1 UTSW 9 18302214 makesense probably null
R7920:Chordc1 UTSW 9 18302101 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGATAGCATAGCATCCTTGG -3'
(R):5'- AGTGGACACTGCAAACGTC -3'

Sequencing Primer
(F):5'- ACCATGCCAGGCTTAGTAGTG -3'
(R):5'- GTGGACACTGCAAACGTCTTTATAC -3'
Posted On2014-10-30