Incidental Mutation 'R2299:Zbtb24'
ID245271
Institutional Source Beutler Lab
Gene Symbol Zbtb24
Ensembl Gene ENSMUSG00000019826
Gene Namezinc finger and BTB domain containing 24
SynonymsZNF450
MMRRC Submission 040298-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2299 (G1)
Quality Score123
Status Validated
Chromosome10
Chromosomal Location41450383-41465574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41464581 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 536 (V536M)
Ref Sequence ENSEMBL: ENSMUSP00000148861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080771] [ENSMUST00000213797]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080771
AA Change: V558M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079592
Gene: ENSMUSG00000019826
AA Change: V558M

DomainStartEndE-ValueType
BTB 37 133 5.81e-26 SMART
AT_hook 159 171 2.23e-1 SMART
low complexity region 248 260 N/A INTRINSIC
ZnF_C2H2 293 315 8.67e-1 SMART
ZnF_C2H2 321 343 4.87e-4 SMART
ZnF_C2H2 349 371 6.42e-4 SMART
ZnF_C2H2 377 399 2.99e-4 SMART
ZnF_C2H2 405 427 9.44e-2 SMART
ZnF_C2H2 433 455 3.26e-5 SMART
ZnF_C2H2 461 483 2.36e-2 SMART
ZnF_C2H2 489 511 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213797
AA Change: V536M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215881
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a protein containing eight C2H2-type zinc fingers and a BTB domain. Expression of this gene is induced by bone morphogenetic protein-2 signaling. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies syndrome-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a deletion in the BTB domain exhibit embryonic lethality between E4.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
4933434E20Rik A G 3: 90,064,538 N68S possibly damaging Het
5031439G07Rik A C 15: 84,953,285 F276V possibly damaging Het
Abca12 C T 1: 71,258,222 V2370I probably damaging Het
Acsl3 T G 1: 78,699,110 C469W probably damaging Het
Adgrg5 A T 8: 94,938,576 I372F possibly damaging Het
Ankrd42 A G 7: 92,590,254 I442T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bmpr1b C A 3: 141,845,202 R376L probably damaging Het
C1qtnf6 T A 15: 78,525,342 T102S probably benign Het
Chordc1 T C 9: 18,302,108 L85P probably damaging Het
Clec2j T A 6: 128,655,236 noncoding transcript Het
Copa T C 1: 172,121,725 I1223T probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyfip2 T A 11: 46,286,131 E74V probably benign Het
Dsg1a A T 18: 20,340,150 D760V probably damaging Het
Folr1 A G 7: 101,863,992 L32P probably damaging Het
Galnt13 A T 2: 55,060,583 R425S possibly damaging Het
Gm4559 A T 7: 142,273,835 C177S unknown Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hist1h2bh A G 13: 23,543,184 S57P probably damaging Het
Kansl1l T C 1: 66,773,477 D459G probably damaging Het
Limd1 A T 9: 123,516,877 K574* probably null Het
Mmrn1 A G 6: 60,976,441 K569E probably damaging Het
Olfr583 T C 7: 103,051,582 W95R probably damaging Het
Ppwd1 T C 13: 104,220,063 M315V probably benign Het
Prss21 A G 17: 23,869,589 E176G probably benign Het
Ptpn23 A G 9: 110,392,513 I173T possibly damaging Het
Rit1 T A 3: 88,726,070 probably null Het
Rnf14 C T 18: 38,308,085 A176V probably benign Het
Sema5a T A 15: 32,562,776 V311E possibly damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
Spire1 A C 18: 67,530,423 L36R probably damaging Het
Usp33 T A 3: 152,374,621 V463E probably damaging Het
Vcpip1 A G 1: 9,745,719 L813S possibly damaging Het
Vmn1r174 A T 7: 23,754,004 I32F probably benign Het
Other mutations in Zbtb24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Zbtb24 APN 10 41451889 missense possibly damaging 0.63
BB009:Zbtb24 UTSW 10 41451508 missense probably benign
BB019:Zbtb24 UTSW 10 41451508 missense probably benign
R0485:Zbtb24 UTSW 10 41464536 missense probably damaging 0.96
R0553:Zbtb24 UTSW 10 41451997 missense possibly damaging 0.78
R0662:Zbtb24 UTSW 10 41462279 missense probably damaging 1.00
R0927:Zbtb24 UTSW 10 41451436 missense probably benign 0.43
R1164:Zbtb24 UTSW 10 41464527 missense probably damaging 1.00
R1456:Zbtb24 UTSW 10 41464993 missense possibly damaging 0.46
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1464:Zbtb24 UTSW 10 41455079 missense probably damaging 1.00
R1873:Zbtb24 UTSW 10 41451127 missense probably benign 0.28
R2371:Zbtb24 UTSW 10 41451268 missense probably damaging 1.00
R4280:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4281:Zbtb24 UTSW 10 41464920 missense probably benign 0.34
R4593:Zbtb24 UTSW 10 41451957 missense possibly damaging 0.89
R4991:Zbtb24 UTSW 10 41456618 splice site probably null
R5262:Zbtb24 UTSW 10 41464560 nonsense probably null
R5371:Zbtb24 UTSW 10 41451541 missense probably benign 0.01
R5393:Zbtb24 UTSW 10 41464582 missense probably damaging 1.00
R5428:Zbtb24 UTSW 10 41464788 missense probably benign
R5785:Zbtb24 UTSW 10 41451853 missense probably benign 0.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6033:Zbtb24 UTSW 10 41464401 missense probably damaging 1.00
R6961:Zbtb24 UTSW 10 41455175 missense probably damaging 1.00
R7189:Zbtb24 UTSW 10 41464476 missense probably benign 0.00
R7407:Zbtb24 UTSW 10 41464779 missense possibly damaging 0.94
R7932:Zbtb24 UTSW 10 41451508 missense probably benign
R8074:Zbtb24 UTSW 10 41451232 missense probably damaging 1.00
Z1176:Zbtb24 UTSW 10 41455190 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGTTCGCTCGCCTAGACAAT -3'
(R):5'- TACTGAGCTGGTTGTTTGCTCCT -3'

Sequencing Primer
(F):5'- GAAGGCACACTTGAAAATCC -3'
(R):5'- TGGAGATGCTCCAGCGTTTC -3'
Posted On2014-10-30