Mutagenetix > Incidental Mutations

Incidental Mutation 'R2299:Zbtb24'

245271

Institutional Source

Beutler Lab

Gene Symbol

Zbtb24

Ensembl Gene

ENSMUSG00000019826

Gene Name

zinc finger and BTB domain containing 24

Synonyms

ZNF450

MMRRC Submission

040298-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2299 (G1)

Quality Score

123

Status

Validated

Chromosome

Chromosomal Location

41450383-41465574 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 41464581 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 536 (V536M)

Ref Sequence

ENSEMBL: ENSMUSP00000148861 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080771] [ENSMUST00000213797]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080771
AA Change: V558M

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000079592
Gene: ENSMUSG00000019826
AA Change: V558M

Domain	Start	End	E-Value	Type
BTB	37	133	5.81e-26	SMART
AT_hook	159	171	2.23e-1	SMART
low complexity region	248	260	N/A	INTRINSIC
ZnF_C2H2	293	315	8.67e-1	SMART
ZnF_C2H2	321	343	4.87e-4	SMART
ZnF_C2H2	349	371	6.42e-4	SMART
ZnF_C2H2	377	399	2.99e-4	SMART
ZnF_C2H2	405	427	9.44e-2	SMART
ZnF_C2H2	433	455	3.26e-5	SMART
ZnF_C2H2	461	483	2.36e-2	SMART
ZnF_C2H2	489	511	7.9e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000213797
AA Change: V536M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215881

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: This gene encodes a protein containing eight C2H2-type zinc fingers and a BTB domain. Expression of this gene is induced by bone morphogenetic protein-2 signaling. Mutation of the related gene in humans causes immunodeficiency-centromeric instability-facial anomalies syndrome-2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a deletion in the BTB domain exhibit embryonic lethality between E4.5 and E9.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930415L06Rik	A	G	X: 89,932,399	M64T	possibly damaging	Het
4933434E20Rik	A	G	3: 90,064,538	N68S	possibly damaging	Het
5031439G07Rik	A	C	15: 84,953,285	F276V	possibly damaging	Het
Abca12	C	T	1: 71,258,222	V2370I	probably damaging	Het
Acsl3	T	G	1: 78,699,110	C469W	probably damaging	Het
Adgrg5	A	T	8: 94,938,576	I372F	possibly damaging	Het
Ankrd42	A	G	7: 92,590,254	I442T	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bmpr1b	C	A	3: 141,845,202	R376L	probably damaging	Het
C1qtnf6	T	A	15: 78,525,342	T102S	probably benign	Het
Chordc1	T	C	9: 18,302,108	L85P	probably damaging	Het
Clec2j	T	A	6: 128,655,236		noncoding transcript	Het
Copa	T	C	1: 172,121,725	I1223T	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyfip2	T	A	11: 46,286,131	E74V	probably benign	Het
Dsg1a	A	T	18: 20,340,150	D760V	probably damaging	Het
Folr1	A	G	7: 101,863,992	L32P	probably damaging	Het
Galnt13	A	T	2: 55,060,583	R425S	possibly damaging	Het
Gm4559	A	T	7: 142,273,835	C177S	unknown	Het
H3f3a	C	T	1: 180,803,138	R117H	probably benign	Het
Hist1h2bh	A	G	13: 23,543,184	S57P	probably damaging	Het
Kansl1l	T	C	1: 66,773,477	D459G	probably damaging	Het
Limd1	A	T	9: 123,516,877	K574*	probably null	Het
Mmrn1	A	G	6: 60,976,441	K569E	probably damaging	Het
Olfr583	T	C	7: 103,051,582	W95R	probably damaging	Het
Ppwd1	T	C	13: 104,220,063	M315V	probably benign	Het
Prss21	A	G	17: 23,869,589	E176G	probably benign	Het
Ptpn23	A	G	9: 110,392,513	I173T	possibly damaging	Het
Rit1	T	A	3: 88,726,070		probably null	Het
Rnf14	C	T	18: 38,308,085	A176V	probably benign	Het
Sema5a	T	A	15: 32,562,776	V311E	possibly damaging	Het
Slc28a2	C	T	2: 122,441,778	Q34*	probably null	Het
Spire1	A	C	18: 67,530,423	L36R	probably damaging	Het
Usp33	T	A	3: 152,374,621	V463E	probably damaging	Het
Vcpip1	A	G	1: 9,745,719	L813S	possibly damaging	Het
Vmn1r174	A	T	7: 23,754,004	I32F	probably benign	Het

Other mutations in Zbtb24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Zbtb24	APN	10	41451889	missense	possibly damaging	0.63
BB009:Zbtb24	UTSW	10	41451508	missense	probably benign
BB019:Zbtb24	UTSW	10	41451508	missense	probably benign
R0485:Zbtb24	UTSW	10	41464536	missense	probably damaging	0.96
R0553:Zbtb24	UTSW	10	41451997	missense	possibly damaging	0.78
R0662:Zbtb24	UTSW	10	41462279	missense	probably damaging	1.00
R0927:Zbtb24	UTSW	10	41451436	missense	probably benign	0.43
R1164:Zbtb24	UTSW	10	41464527	missense	probably damaging	1.00
R1456:Zbtb24	UTSW	10	41464993	missense	possibly damaging	0.46
R1464:Zbtb24	UTSW	10	41455079	missense	probably damaging	1.00
R1464:Zbtb24	UTSW	10	41455079	missense	probably damaging	1.00
R1873:Zbtb24	UTSW	10	41451127	missense	probably benign	0.28
R2371:Zbtb24	UTSW	10	41451268	missense	probably damaging	1.00
R4280:Zbtb24	UTSW	10	41464920	missense	probably benign	0.34
R4281:Zbtb24	UTSW	10	41464920	missense	probably benign	0.34
R4593:Zbtb24	UTSW	10	41451957	missense	possibly damaging	0.89
R4991:Zbtb24	UTSW	10	41456618	splice site	probably null
R5262:Zbtb24	UTSW	10	41464560	nonsense	probably null
R5371:Zbtb24	UTSW	10	41451541	missense	probably benign	0.01
R5393:Zbtb24	UTSW	10	41464582	missense	probably damaging	1.00
R5428:Zbtb24	UTSW	10	41464788	missense	probably benign
R5785:Zbtb24	UTSW	10	41451853	missense	probably benign	0.00
R6033:Zbtb24	UTSW	10	41464401	missense	probably damaging	1.00
R6033:Zbtb24	UTSW	10	41464401	missense	probably damaging	1.00
R6961:Zbtb24	UTSW	10	41455175	missense	probably damaging	1.00
R7189:Zbtb24	UTSW	10	41464476	missense	probably benign	0.00
R7407:Zbtb24	UTSW	10	41464779	missense	possibly damaging	0.94
R7932:Zbtb24	UTSW	10	41451508	missense	probably benign
R8074:Zbtb24	UTSW	10	41451232	missense	probably damaging	1.00
Z1176:Zbtb24	UTSW	10	41455190	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACAGTTCGCTCGCCTAGACAAT -3'
(R):5'- TACTGAGCTGGTTGTTTGCTCCT -3'

Sequencing Primer
(F):5'- GAAGGCACACTTGAAAATCC -3'
(R):5'- TGGAGATGCTCCAGCGTTTC -3'

Posted On

2014-10-30